%PDF-1.4 % 39 0 obj <> endobj xref 39 94 0000000016 00000 n 0000002719 00000 n 0000002874 00000 n 0000003443 00000 n 0000003755 00000 n 0000004236 00000 n 0000004493 00000 n 0000004606 00000 n 0000006826 00000 n 0000009158 00000 n 0000011455 00000 n 0000013782 00000 n 0000015641 00000 n 0000017773 00000 n 0000017949 00000 n 0000020065 00000 n 0000020546 00000 n 0000020982 00000 n 0000022835 00000 n 0000022870 00000 n 0000025393 00000 n 0000025850 00000 n 0000487742 00000 n 0000487819 00000 n 0000487896 00000 n 0000572934 00000 n 0000575457 00000 n 0000575575 00000 n 0000575609 00000 n 0000575686 00000 n 0000592879 00000 n 0000593203 00000 n 0000593266 00000 n 0000593380 00000 n 0000593457 00000 n 0000593531 00000 n 0000593605 00000 n 0000593683 00000 n 0000593823 00000 n 0000593970 00000 n 0000594278 00000 n 0000594331 00000 n 0000594445 00000 n 0000594467 00000 n 0000594544 00000 n 0000594656 00000 n 0000599356 00000 n 0000599419 00000 n 0000599533 00000 n 0000599610 00000 n 0000599919 00000 n 0000599972 00000 n 0000600086 00000 n 0000601230 00000 n 0000601549 00000 n 0000601906 00000 n 0000603320 00000 n 0000603647 00000 n 0000604023 00000 n 0000604159 00000 n 0000606722 00000 n 0000607033 00000 n 0000607434 00000 n 0000607498 00000 n 0000607533 00000 n 0000607611 00000 n 0000733777 00000 n 0000734106 00000 n 0000734172 00000 n 0000734290 00000 n 0000734325 00000 n 0000734403 00000 n 0000734515 00000 n 0000881094 00000 n 0000881424 00000 n 0000881490 00000 n 0000881608 00000 n 0000886408 00000 n 0000886486 00000 n 0000886674 00000 n 0000887737 00000 n 0000888800 00000 n 0000911213 00000 n 0001044213 00000 n 0001045276 00000 n 0001046339 00000 n 0001068589 00000 n 0001274779 00000 n 0001275761 00000 n 0001276743 00000 n 0001294955 00000 n 0001454858 00000 n 0000002552 00000 n 0000002176 00000 n trailer <<3CB1D48C8EAB4CB0A652C86FBC398E63>]/Prev 1458617/XRefStm 2552>> startxref 0 %%EOF 132 0 obj <>stream h\=K`7Im5b3qRP8" ũR\t|H?d(ұq*8 QA=8n8yc; P*?LbLP giF(r¶M3qA4IN}FqG\N3)=tɓ,yZybAlCD'jJr)|PbzNElz\@ $5X$%4QXg;ޛ-)iue-"f1fw*vzߟ_]^ϾMZ C endstream endobj 131 0 obj <>/Filter/FlateDecode/Index[5 34]/Length 20/Size 39/Type/XRef/W[1 1 1]>>stream hbbbd`b``h `i endstream endobj 40 0 obj <>/Metadata 3 0 R/Pages 2 0 R/StructTreeRoot 5 0 R/Type/Catalog/ViewerPreferences<>>> endobj 41 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text/ImageC]/XObject<>>>/Rotate 0/StructParents 1/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 42 0 obj <> endobj 43 0 obj <> endobj 44 0 obj <> endobj 45 0 obj <> endobj 46 0 obj <>stream HW]\5}v/ !؄0$&{N՝0!Ir>N]RHI}p|w8_./OSx+v_NޛɲݫO |{\4QC%Ωrq4??.|{;C b Y[ ?{mꯗwHklnt^.EY҃l)#|#+s :?-/[䣤'-EI-XŞgEAp;b3IcqwMW1j\-mR(\@u9>C4^v}{!_U b#rBkǯIJ"7ce5!bќJI"),O,_sz68ILiCR\ hJňT6Fmd.Mcwyz|=zz2y~~{z+i&\oˏxbjԤlUAww|H7_G'?.[:oIZU[_=Ua9dI-'a}!yKkywgZpV(আxk0UvkOI8]{xOխ(?2T00P@8z:[葊 wUZ3{?wzӋχڿP̢#2f mZ ʦu?ɳw#(.JL$ r\ X&SmPfk'@BMgD7EkE5G8TQ[a,l [p\{%Vdb"H 2pXJ?IqڰOOP8ѕJ>QL{-}+Nܐӌ= sW }Kht#Q 3g9bX)B0*33O?io 1M"yt82p&Vb k~|!{RjYzWWG2'4tZ{u>Z \Q^\nxhȇ|j›U'f-+ $u;5 ҩTC 5d$dܬ#4E""C <ulBn/BԅE\cKex> >uupۦ`upplwE\PT;lt[sl ~J\ J\h<\lŵ"T I=#2n½ͷHAPLP-4ol-l apā0.*M M x VSicۓ g&pgX*;V3#a+ U6&o@qQM(ɃަïԼm[rݨ(SFrE%;O_oZMH @^= `ԫ۵%0Y5t˥6>܊(0n*x3uNp$H* D NR"c%an|BL۞ֲ[jQجxmܭ2mY 9=S,0d'lAbHDGMm^ @-ۛT7}S-=!y >stream H\K;DwL5xA'ehp]('|bwy$א^sކ{>Zn]i4i}h};\%՞o:-|w& q+@s[!ۺ!rj{_o׻+YKcq㖘c|{o%c{0ywaݿp_.!w]]2GY[>ܼs7^18z_#4mJ>~Pc?=vpM}qﻮ&۵~ҿju[C;_g .%AЇ:m/sJ=>|qsjH.9ۛ?:3o>^|y˭oqC;:нYW=+77xN 4JH}ؤ)YG\$[X}/qAy,bFrKԫ\~|>-NrZAr SLgeO>CtTCn/Wq(iqsO4 mRMd-ݮ@rj;1pcY33_I[x3J2,CRN's_h9'u^fc't2l 1Uag>mO6JcsJzu_[·XY0ƙ^ÖWR RwYTlS1 N_nQǪdQPa5HH먰i@@=@ZA,$8ujWe/aJ**_ ElíŰqS\vҟpD"}%|igt&Jh$w)S`yHB!:鎺ze!6'7N"LشH(_uM BmZCHw.2pav`S¶b@q.[p`B:! C ލkI>@do4MnBx2Sl@G7uv|Ԥ nG^f$2/R\) 18F*|8ՅOb6*,ւwj6M<#c{/n%x^ŠU`Jcm36QSy)1XY/:$W362NxQpmK th*'i]ݛk\vwui`*{ܚ;Yfw=*FH%yT1Q  yGBJeڤDOԁթmK7k-"?Bg5ˆ6;I  ȣ; z Qۀd[|D8qܚT!G2E9Z$eiϣ!85 %WQQ!V#fWϪaإ>}u޲S7ݓՃq[Fkjԍ8#iJz^0H]Xu.(jI)}QOuHȷ-L( endstream endobj 48 0 obj <>stream Hl=6 9E_`(Q1|l?S^Á1a"R7u}2;dO_?2--y~1_vAo5!~>pɶ[fVǕIP?8mZ@  *sF9pzufK:.MqF;]Ξei9k{|3P?U'k+QjAWSGy2v9"F#¯/նʜqdo=GuZsgD3~Sw€MDJ txEZi;3a_xy!{|u#fBo5oٱ>\_ `!H@Uֿm +xMjj_5]#Xb8NT6k9R`VI@X΂e6 jZIP AH4b-{w2YӁI;P̋2?\Up x@U[l%懞!*kKfMPo3 J!$F_< T)DY(̴-thPO_?mAKXF= _L:\;1Y5KHܯ&4r-8F)`RQi;PeѽHRxz*E=/8n4S9Ф\Nq.RZdB=l;NdJ!:JmZ$}efcKojW#Q$6"i119KT49z 8O g,tq:Se!,Wi~^!}Ć%$X+{ug: UмVzp^4þzd*.Ox!`[=2ᏰQŇlxi1Z6?Q0,1@sMԕZ[Ng-J&tA^dݛQ gp CsA鰴\q,mJd8[BIuϨ눾Кn>EM #Ź*N;jz4Y .%) 3GFʻÚ%u/ܨIC䧲Ù| 5*t;p c`/d.=/?~|]D&N@N;~vM%"B/)>pw"!x51S-GbQ2}IG p-2:٭qK&:*vwzY}F9cUꧏƖ.eV%B}K.)P:=+9g.CG9!kT-80t8 endstream endobj 49 0 obj <>stream HlK$9Dy @8DQc ]/~fE!`Hx3me՟_?o~~>xg9鸬덶{yz'ޞl,,kVٵl,Z!sG<Ў6V p!375NzO7[<}seu6,8ۆ;}0 ~_PrSf[^+޷]6blo}~&-(PI, if=xR0< :N!1%s?NR=xdk{QxOV kW{#ƃ p^;+>a{x8`SE$!2bmk bgLl!d~H2?(W<$ J}< NH/Vjk9P*}9]K!m\MPBAرTj!h*)МDrXeH?rѯsqr;@_xqDJbgA' *rj Ҋ߯Oآt@[ Ga LN+Pi>v ؗ*:b<sL5.M&'HCb\CoVHeÓ!MJKp;yy`F NQ&($BL@a;;4$'G駡/lLZ1t'qz<ջOYRNvG$D+/Ǭ?$N/Rb47 N";} n¼h ~WGj 4w{XkOfnTчZrg|p=EIU{V/x뇻fӹP'LHB4:w,ʦc?4H~`TRd>˿`|$RUm!j8q>Bb(.=noj&M:zP9+Ve|EMpWo#+mmE@P'\ 0&\r5g%5>9MiLR-*XO㰙o2״I i<"% \vΗ,ENZ䨹z/+5j.+ኵ ˚lNEt[{a7II65LަKԤz,+K$r.D s^JcgN?54g%HWK_(4(f7r6[F8@iwT"$~abДOν7y}(M ?$Sb^{{kikRFVDqyDf]I Dz.E(/$N,Njp.au^Go:2wQ@ފʻF!$O` RѴve\>stream HW^7Oq$Y0a<@0ɬSU:2:`}#V_j'.-zbJN캷z|^$6ZLǪ~VŽٲۜɖ끷2CŴco5~ݻq%saطhpYmdƱ[KN[瞡>.x3郵Uρ,doJxopϙ́ۇl%̣,z5[~;U| ;r2ط6m4>Ys7/Ɨq& z]\BLqGb+σeEY)|~`{dYDR%NXIVݱp1 u2( ET2@EۧăGC}F8z#ʾ,"ܡ&kfaLb uLYG?-$)lj0Y!^?ΝJΣR7$@&hP^0Wd"NȗQaKC9&,ˋ2|y*ɺ v_)'f3INzb!s^xE)`T#QgWQe1f[Tn`}I0&xA0QHEWQN#ц=pgeH q֖RE5*  jbDlp,6McQhppS "k T !q "?gX?R5/ D8d?S}}AZ( "kEݒ 0vvuѲ,^LJ8( ";E/TQPa3|?9Ap8yTb*]WsFYX?~{K(R¨` 6ӓm*ݭhzԎMig`KC1ΌC\ ~6[lA2 c}#,!B3-tco.d *Kᘈ slazwT:t JЫU,O IHM=L$'"3 R憢qZLJƗJL:d㘦>Dwى.?!5 Kj^,;!d ,@-J`2qʭ򎛅taA3OUcӱy6U$%[Wjn~\nGy4,{;x 9G_\2)Dz>g3! Dyrr.bwX1UZ eueuZߣò3ݬ3r~\MęXDj: F_3eSrfǙC`<~_0. ĕLEŕ"4V/JaNfI ~olKZi d!~p?łS,û87{hu4 g3n4t*3CZmV_hZ}b;I\^"tk`L[q(ΏPSdksVRÐ:M,懳LO:9꧅4mK-α0?s,?q^`d RFV endstream endobj 51 0 obj <>stream HWM5_1Gn%! 8(BAH>Uճ ~(ʾ7v?{X6ȳ<fs^8g4?kqƝ09Sٱ׽X\mu.ڤ';mtcsqm$yXd>i>`2S#;M9ˆU$k?UYeSk#"ɇ-!6*@ehx;Bct΃7LBVr&QHg~V5a! i.+{6W8J;-˶9S.0CޜyɶMκvˆ-7aVbDMf9,&d_7Ua~P iYgS"!?TiBNd?K g' .'O-΀f uq=ܛB0^C] }4W/ *W]Os'ĘE@( L"}ge)/%;eP|fTW;t!i `uJ3 Xpc h]kb,Q1,&}RԨ݊tK)D,\iuxp,k vbl$WƼ:%=$TdI0ʭgb :/?ĸ"L'\Ʉ`Q G(Y<FS#JAv[bN l䄋ȫRP:yDۭC!P`P?APM%Sn \)A8rsqj.5SϢX"1N#"[40PM\m F2Dpf!ؑt:9 ]++]p.F/4ORWv9YT[qtOR1 j4l;}#TuEN)WbZRh7@owl\&qppEfͨwơhz\AI*<Pv`)Q钉jLZla-i?E#tJſ:^BF<"GuӐ9HþKJ4xkhN8m|#k*ci4jJ.,N )3Lz=tz|/?=>ٗ?}s|o^={y|O\9g|x >(06V?ρxFE\m!;H^5oZ_t|`/MI>w?|q_ѯxx{+2n] 8ޑ*>] endobj 53 0 obj <>stream HW;$ u $Ƒ3lfYc]K"^7X$> [;w=+c55sӪx~|l|$?+lqI̢Ur'7?k۸0Bg܊ǭ7i8^8׹6}F%֞u8mVX:>jҳZgg|]ҬE#ð2y&)~ةJz60tϿ?1 o8DZ~;8$RD$D~<ﱰ1~ GLOĮޮk.fv>/#VZ4C_+OsaN37AL '{p/}-dFha3Vz/cҌ &s_P 18],eaDIcj~|Apk ~Y>9@YhYQ8ˣ7%wbܳcHG1a?Ea_mE{%$9@_LhNY2" ʋ:Fdg ݮTN^ǒIx664Up$s,]#c0XΆE ?o^B7P)fdN]vǙq'km6 vkvg`u2O9c :c͏ Ra5!McW:_zITOW)hWPT=8e&)! nA3(Td;D>@#Ng FN .)!8<)AYwNz1H%I^Fy 6GPOiDЇi< Ta"xX%Uclb+{KgμOs%D-oĦxa-&!H:BGh:Ȳf'N|uІb0[;G7v"}C'C u6[+jVB ؏Zo\b\Mc"R(a3κ$lPs\Z i@ſ|yKGq0I:Iuqug]Xi͐n^^͊RBBcD:ݡR&P{5J߭x"jd-y+)Kw]R}@D@wJ!Tے·,u亗$!ʭY,.U ^;)=ͩs PӂZbkBrRxX]Lݳ()A;,50^Ͼ7|4dyi46M >0] endstream endobj 54 0 obj <>/ExtGState<>/ProcSet[/PDF/ImageC]/XObject<>>>/StructParents 0/Subtype/Form>>stream HT;0 ݧp' 1@10T Ԃe?6<|W .bH#Zbl !K$W?#>0U &8Yэlx- ޙm9Vn+VEe>WgVSI^<` O d&%#K0H endstream endobj 55 0 obj <>/ExtGState<>/ProcSet[/PDF/ImageC]/XObject<>>>/StructParents 2/Subtype/Form>>stream HD 0Dn6M6BV?@DVQ xfyBӸzvwU8jLj5P?(.tn/8H>Y.VSȒrYJ Džܰ;M˛> (&# endstream endobj 56 0 obj <>stream HWn\7slna #@l RKly8pAN0i>.TmG9lE#j_fSbU g˶{Ұm̯VR }n [X Kb.rl8Wb/k8ƠUC|W]k)uZuZ2+eݵ K\"1uq2̄Ö:gc$X#OaS3՘t0JVCdm`҈,oyblUrố-l yD'gKZfQűaF cU<cLvBe KsH;[_Nm%ECKH˅?r%4pcxR% I2^a ӣ6:1#ճb_ e݆ci~*114t&_1쯾sB ܡ-+J,Y(S`ҘD5C|κYa#\<'I+%VgҠ i,24WpR%)V(aq܃.(ِ1:!m>&m κcs y ˤ0l'L3gmG;, 5q&UE ӑ p8]0 qsαp)Or³ ܈DEFx$eئ2HirSp+%2' ʜplZb@a~ ΛM?&y*Ou5\qa䟸=0-a!9SWyk`n-5!BbZy>MXErΛwPH} Gƣ-;Y BQAC*;&gF1Nm"NASՕ'W(*a<"Twv:Yu#4R&oncpfanRl]G쀯ͿĚ39;'pYĶ SQ䶊V.V /$t_0k{]ݥ<4o?DI K{Og lVN3,aPV#\q4o-pa¤t$5N*A <wz<"i٠<^` gsD&jOǧHw!'({)?ZoT;Pp2Qљߧ Yl\'OD%nv:'3{\uދsahت]{셳ƀ́#mTb%w`Hr4x\p16ȿxWgyPFdbhu8f@^|?K[ΊCwܯ~ G|[;9^HeI7(b{Sջ_{tnWl 5TBEfޠ[|GntϓE:#ɉ=}ve1x  0̊ endstream endobj 57 0 obj [/ICCBased 59 0 R] endobj 58 0 obj <>stream Pixar endstream endobj 59 0 obj <>stream HKPO"RեTZ6vvA>4}!iIS\ ſ@WU'_Vt(\ޜs$nX<cK+NxCZ,> <7m`BO-tB?StvSIfRqofntnLN<_1ܦjEaʊɦ MW,-oEE>v4u"e~~2V|9r+,Z'B>jKW{@s:򦘕"%tǀ7ۮ }^Sۮ}̭_ ڻo( ?]`8<Fa H(I[Hn endstream endobj 60 0 obj <>stream Adobed                   $     m!1AQ"aq2#BRb3r$C %4Scs &'()*56789:DEFGHIJTUVWXYZdefghijtuvwxyz{!1AQa"q2B#3R 4r$%&'()*56789:CDEFGHIJSTUVWXYZbcdefghijstuvwxyz ?_AH+~~xp\)OqǨjRgufmp ڸCsH)%]>㓳 ?BA=pD g4{ h}4q#ГH"?~qD;u8t8 =78W~\q)ǨޗiXЎmޡx~E(Iu]"'!ĬfKISV@U TN_莟Kuz2= w{@;>g S2"Wꐔ㯹3YoiUGNfwaxCN2ƛp:{İc vZwD:ޥߛ+/԰XaҘվďoբ<=Wʿ ILJգw֐[Jt^Q9u[/&mX_`%GC{ 3G5%(&$ϷוŬsz}'@P,SIojMe#6.l[{t$(=>SQM~'heM}0 lS7[ZJaD#Fez\82Wq&𽟰Dzgř3"au>7,/mwfI涼SȘ[_[i !26۞~ mKNI8WҺSK˸ jt4.I*@"`O NXŵ;w,#E%*W-,1$Uo)W^:m>:˔I5~@sƱ][Pyr?eyV,3dr\/:$yjqN*#?YG/nI$ ׳ԭ0 ZbM OaK wi6Ki($ *wp6NUdZǻL-:C'j\)95lF[g WoP q˥9(«#Y56b{<>}ۦO.Z)O LήjjxM⭴b,%l7U}3:բSC #Tt(xhLeEiɄbu:Lkm쐩 *E;{<~Ik\w^*_&k/kⲆ\5oڗ #DT:gVZ}=𺤯}5Iߤ]*  qoބ!(*;&$"1>2rKv8qUzpv]~%)FR*}=ު?',$ޯtpހ4ەz~G nmJb[6 ^J4)M SNd۪V(Ϙe[**2*3-Z_<*g}qo|%ŋ %Is؏plԥ$<'~Hu hUm)\Ɏ[V^/9d'`jI="+c]KBӮ4J >OiԗgW:J%8cL|m 'v|e,G$EZXbL1p /3F|r^ ,Y' gJ.hhc<ڴ?苎zRiMi{ͻ\zzjJw ޲T>.CeqjaD1#T4*85+ "G~sC¬Im^%NN-m")8refpTX;LL߄/!%ZK1{6 JY\)*;or{sko[[ȊQc@{S#1\>:K$>{:F鈪)žSڸwH@JyIrK:S!Bn-R Ni&0,[>`֗g y%W#QN5LA;Pc)wil*xWdt-˫ r*Q AēV]oǦx4WI|w@>Sޠ3.HɫVy=Ks}88);ҝw RBx/6v(! B3"@+u^)eӻn}iJbw+$֑R1G"CzI=&$]G]/ (3b)N_ ".S v;Zˏު4ﱚ Vl+21L0~зFWwI}REqD5uQܜ~q;W ?t \)?=qGqjwS 8k)#Oq\q G j@@k\wOIg6# Y\qL5wH:F~ {W{Hu3؃\''Hv܋G p i)N?\r=AR iuH)A3Aܟi⻓=q!gc g={ u t{AOz([:j"CIWu ]GY(h=;R ~: `Ap<R~H-ѱIoTzHH8)GkRPz4O4=I:7R6H)$McFR=l&&iH8\?`w9o\)ҐS\w'jADZ:IMb؟ i?@SRNԖ-q~Z|AO@]ȧ @jž4OcjAO+T`M!ǪAN?@kBޣ}$BwR SlQQ؞X:4TryXӼ|GܟHտ~=^-h%ncW)?(Y(%jkеÎ-b94%٦抚 lyvZt)1 ;N:u8=6 d{b$<^FBŰ(4񹬚VR*ɢ_fq9-3KAxMkvG0Hx~kV7!+Sw[(o(`q,٦tQNOSA j[[|=9QSHZAXӱa3^1Nו+]KY]]X) \[LWR@VeGbx.,lYВ>+KּrJ*n2Gbm{/1 ]}-[gaB#t@O2ti2z\#oM.I.Ga0mۍRh>58י8sùlӸ_ETe[߹s%R W'mv=VåoZ[xJ¢:lMm~.L-ݩT6 $7"=Js =im?ߐ5(䭼(XmhJ}'`NJoyEclwx.hEXNVp_]}ZEw"zrzN'E6K&D"N*v@Y N2&~ٺY["L{'WTk&II#RtVl6mY:Zm2.xG"r9Ig-Cq BR`Tv Vpz,O̘omZK?x@Dr㛖Wi>J:[(㫳D+HgS\ɎQη0B”L{CjBxQKJP])Þ/]^kQY aUyzn忒mt]lgANxy2d/nqjRI$Ҭ2͍I"7dvTSws׮<$Dj I ڦ$#ZQ{%:}cQogΔVp'./>)q~A%o :wCݪD{m܂!JUtF0b7Y*?,}A0w1HplE2XpѸzC$C)?`JqDm\wH*g;҈zM%G$g"OW] VF ~\"?+?$Ԧs1\)DW+=?*"p+dmH+?ҝg?4:q:q\qG~+\'H9W{}?\!p?E!${~+??zAʸS83W;R=g=?@k?tθmuNW `l:qPz)=)NI 11HuШHu Ep{x4YjC\-\%3%E铽+[~w ŕfTn ~x`A7neJ RSRF[zZ)9-bühNb̩Kei.o)'`OwKOpmdZѤd۳ۥ lߔ$q5*ze /)ҵ+kUxWmX:[|:1xӈ.(T?K۩8tbɅ%&ӋZ=B(ɧ}/~^abemvD{E(ԥX ?m# ku$HCTȜޗ ԖۡHK,eekt+IoB&K 5+‹'byK.ytT@T%:C̓G[ܴ|,E/Q7*=a[ݼ8t gW>=௢ӔrړrjK{&9v'њ>N|I%G=[OG&8MkR[\tٿVsmlvPp+ T,!q dzd Xx>1J._h4z[}\!wgxm sjA*#;(B P7WM7.ܯ>xݪ}(xKlXE(ݱ@Ce IU|pϡqB//~WA.K,\><].-n0;;娶L@O ' ˦(xi5z7(=B[q -ZQY'TR9)Mjܗ5[o\¯зo<*²kjuÍ-d)v;mDž{UfrxpMj&>Zo,œ -'i5sK,xE]%xnIsKOn~UkI[w[V`VӪ qʅRǺ"Je v*tDwc3O!.HLA]%d~_jfP} R?o2G4]VȓZR;i|intkem^![NƄz/Q1SK۶H ؏A}nWb MV,nR[7LژJVSİGu)zvTn#~ԣtG-,,e~&[6Ĩ:ٔ%F ;gӨV[Rnԗ9!%!'1ZGwvIjH(^Ҟ<Kb߸Rtiѿ°+ K>aNvH}wK."u$tV?OtX6$4MW|d} p,`bԷZo`X^,gM9;ե߷ș:@:o TRM=O/R>f/pZ!IdJ6gc;U|99h˘ 4ORP{ă ÎqxuG}wڦZ#cU_!#-lYY;LvŃWIy:\GaQͥ?qC/A%k a7%n6).Z-jIQ]Y Ҫs[;ۄRꭅp|j2kP+:kqe"f۝E ;. qe GR#y8T#}ۀ@OHb{P,K,XHƧ6?mk? Z92K)se*b[>۠$G'iPN5%ŵz.<Օe*-ԦZLXP7#ڇ Eޔ?M'fVe37(@!xoDLЃ\ϦQk__۰ 2஫|`T4uٵpwή"+wn)bDJ2q |+2z[ ?/q<. E;n͍Ä@rwֺ^[dAҞsҹS'oƔ֓8E)Hq~m\+?=43C)Q ??b":R?9 \q yL q+9$W~OZQOҒ))\qYyI5` G=?c\w'Hq@;W឴]gQ9 qpz)DAO=$p7g&zAO$84\uH)+?#jCh 6{@NԂ!ǯ 6OzR zӷƸojAl~5qǭ$oH)ST4?RQ DG}u:H*G¢5Ñ2zSzH@1MY7;M[RP5Dmޜ6xE:Qh6lzLWAOA$RYzJOΑtH-4~Muz` b)8 ڸZ:4):E%G ~\GHq`R ~\q4q {AǴ=5) 62[u)!R7IgiH|O KA%IVUux5J1nJqbRM32fc!Uʷ-؄~2M6͢_-\Em30`VB ^Rj'%RUWas[W e yTobUKg9΂_1ˋWYd0ǘ>#Jd>'YG$w-u2~[`.4?sV:P iIiN/OCWqo ؝`@_I>/2~;[e1[F6IRҮJH0ۛ7\;qht(t#vG5%*U `JPœKTܚJ%K~o݊rHx?L[Emi;xτZ]ԯKڷcV7'{1Wlei I ~:yMJv ;q._]ʐIMВJ7m:lZ bҰ7NQVqBl/ ^ ~VBmٶ0&QaZL>S'K[I{4iE}_ Q297NЎޭ<'/N,c[^qG)4`!]ِUt΢?Pٯ/cI[Voګζ|T{jG>YgL\V2sůpwlR_p$GnbN_֨n9;VWsw 0EO j0X'v4F?۸/Dm;Tub?f^S&eς]ĭ{Z cx$u5|./iŶ}?~%~iJL.B?8: Փ!m]anRVSԘ:u$lcUon*)E$L9u=Ϻ!c n֍)G{Q*][q.%E:`IW#{vŻεjm)-$!NBIL G5'^E_VU: F`ݨX4軒xinp bJ,q-JNSp0SeA'&Yŧ_,j_$4%3R dˋviB |uڙ$sԖȎJ-TjRQQu @*TuB;nZA$ }35S藋1˲=ԅ#yQ3&8޵MXkg9[{ q6K Zlj̰5uX*h&З6P"" ނ1 ! #u e ZN8[Bң#y#jkC?`aZ`/m^ap\ yk s2d'*1kjۺI4]yic}< kcӣ 7!d5Ir%ˈ>kC}'tH^!Vӹs^yL~zҜ)=gMqv?}qO^p8&~޸W~\qʸN5E!L)ܟ~8wSBdqHq#jw~&+ V"=NibF~Up2+\'?cpM#9s\qDqVqKJ4SLz)Σ{AOdN􂟑Q'ni,IܚAOИߚ45žC}NgڐS88AHqi?`?mp!I8q Gid~F*=R G;9n~\*=m; ~,i~=kgh\) {qH8=@NES~A@JLco5=3FyJ0o]bz\wjAQ&i)zE TB G+?J#{ CCCǰ'Cԍ=qH)) g+=H)"SzO==+G\qզ{ɓFlinpH}?xO298ͤZOK+^Ev7E &KIIOVgN1]I8]`sŮn%);+R_u)]'ۈ'Cʦ=c}õJ4Z8g9e \>M>Tdo''y j[/O -J Qy)EeN zH?Nv^_ƞiiDAcG^X+[H~00uL)q*1Mɽ1ˑr9a8:j *&.l\xYl}jTJ*ު|Crt(}Z3e\B+e4@yҔqGN183nSnmhsЅ>ިxjR^5*-LSєqh2آȂV%kRyɞ{C,)Sʣ?,]k۪աf=ǥk>naKvt]_7"79xfZZm#WW&|$zxa%$^yƱ\alhS/6$<0cvvp3hna%A᫅#$}O \)ZS۞O7W+"c-~)O äc<*y-䃸/˖UUvM\cw˴mhMI(Eݎǡ;SpuǞ2nRu(z)*p Rn,p5_lﷱ A[D(Eh\kkO98^S_q-ynu7<3.RW|.\` 8koBgj"0շtRV@I9o KE-:J1lo4+ٱPS< ZIYBNڔQ[UzT[b^(5s6XZ-܂4H ՝O<^):źmvBRnZj1xW|Ycv5:@ T+m[sG(XQ?vpmZ[0I7FTxo̖w.?ά܎0zb7I-[P6eo@O²+gLYN'#dYibx<*yr,:zu\Qe6ڗsd|'- X[3Q'p}*0nVSg_[ǮJ&]1¶ٶ]o?'pPšM+̍6~Oc eɖKwl8G[lmHWȊ#?E ڛMI-IzqkI٭_\bIJR.J<(uۚ:gAV+k};ٻGgŌˌaHY2S3">烖[{%w:y]q<8|`7HIW;):I6%ikV9+'ՋߚYulH̃1|:w[-$l>t&|G4_8gCLOROg,><){g5rŰ\Xޏβ Гii} !zѻBSV#V]G\<VI>ٍZNv⒏qQ'PW& lM|. w; ^*oPk.1|%P%kpp*mIR~-Cce]F5s\!pƒҶ,8 _[!iM^]-$L M8շO\)Xb[/u*w_':"V9pڭ-BA=?~(׺!*8n.K +HFVyTJԎrs<05ۛjKRt%DnwOMSu~ SFUtRչCsnJ'Ob[O/cK*7?WIԾI[{WԎj0=el Ixio7@Nryڴ:=;.x櫹_2Zu ZA$ﴚ(n%!C~b]9XyKXp!f;iHz8Ÿ7-^߬k!o?8wWUq-tĉi)@AqZtgf{/^,?Ժȯ~\uG¸CW ~G\#?vg8LRl7Wخ8W~]gQ&S=;W~DW~\)7&p=qSҔi4Ҙ3\qC)N=oH)dg:WH/GOHrG\)yTgjQ)?'?BgKG4”CM "zz@8dEg£ u~ƞYLoH)$ƸS@8q)< tAOԈڸ'ڐjOCq iuz! LsIb+E L=OƐ@H~R3@Ÿm=+= G`R gbS$Al)C=% vz)LK:a4H%OJQ(EH9iWX),T# DHq舮9zž9AAH9W|=D\))= zސ[=!ǺAH87ސr=R {S1葬2NiyQIi*>k:;3}K$n}vt1Ԕn@PPT"#^GxvL]f\M#'>N (d)q ?4IS;P3տDg䛌1vT> LHĿWqrO >6|R\qR@hp*۹jڜq+W>`#yZ\hR!I3E]hN놶odת32mv ¡]#_6 Y2o#V˿&alOb/Y\@G;So{_JewO?q]F xeNEiKR) J'dd%u(lf:AIVԢR[5tJ{V?\L(H{CvW-[J2:)rKbGaKqw(ZVT}Cư9"FN*qĶѮ}!F:.lBun@qP:V <{2=Zs٢\WLT(Ʋ~;оνIoYMopm|6u!RzL~QPko.5P}gxQq5)!$(vL^Qۤ.M_s>JI\Cz]7!ZF sǫ n-/nB5k& aEUW({ʾpR=lj{׵behʏb7X 2! lfTI7{/ss7ndFޛ/w,-"e26VVI7HZW:F=9IJů*C4ݶi2R춼~k06cӡ͵u<&>m+T~.=hx6Zb,_Y8쀆̆Ȓ6@c:yv݈-;y_k擰D~V1pr$i52CâXi"fR&>f 0e\#ңZJuևmiթRw׸c]՟S`ڌ$OþK'qeVqq,wa~E['#+gR㻯Aʢԍ[& [ۺQy|w=07O m(1LbY+fvyc8u-@. C}(l*^(Ŵu,dϖuKKƁN*@M[S$~`!plKKxiJou:ONVayw^/sv?YS a&}>+GWq}Dy{ +iѭe>{D-xx%ż^LBɄkHcRҤ!e Bt$PN?J+/?qFN0U}@qxo2 ¿.&m |6VޱUkM]걶oQm,<?a~:J^MhqD6V0捴q5orv- 3-טaa)uęW;H`x5t6JA9n@3 p搼7/4)iZgGzyڪmo`xco-({R]ZN>D|ôJE|6O$%sq\H"z28}sؑam8I>L"m ]J`=A-<=2l":Yis8d({R>?<)TnZ;R da"PkKYq!+QT LmG3ncՂ < FNoB69f2Tv0b8x`kW&wڐ;,ihDJ,-nLn>,lQL]LAI;{ e!{mh4r!A*WRLX{W{ ]۬#B܈jzջkߏ"=<ĚP+?H!Gɮ8(]by)J4;H-k?r<5 WI  γGXd%*u8XёP;~+OH #帎M2ۺOԞRi.}b,'. WG>{VZ]4:nm775VPG\tv8^f,'7֝M0JN |YEt]V8Kg4['{E_>.SOѮ:++e•8;y'~Pxo(W:_#˪})b6Y$H2v5qˮ 7nqj W^ ai=I]pS1H莿Ҩ:ުI&}c1XW\ )ȟPy֯|cshRݶ2bRo=]p֑l^DZhY4J@xɅN8!Q:Ig|gcXip fnYK㷘7<ܧ*̘Z')Qt_fשxŎg5rH j JI;j3׻7\qqTelo2HPgWODSЎ g5Us.L-@+OO*IEF{sJIg;X/7.x%lNZ^`〝a$&NX sX&Z|WoD1[12х(ZUj)+&,q%Q\v3'{4bWMmDH QlLx#277VqVaGbu4 9zFj7•fey͆((Ꟶ`dgJ*q_[]p8.>f`F}v{wYsKV4]_r*^'h{~GoI>'QRM=7z P qœ-s峍< jky@13QnוJdSö.,MN:U-]<D9}@F-] m_Tm($6~Ec+nSJJҊkg]UM=<4%Aۼ-{{4J[6;isJ=%E$@;Quy$:؁AGop}eG38-O'<e?,2r-W|dN#Bm0o,_uo0@Sk^)#B ۊ~}\_}/“Eybkim[LFjСk:bwJd\ܹxQ,43urޖԟхprp&qo:PG$4NީVl~WMb[A}D)dSiU5̍:m$ a,[a7N3i&GQ}il P$=ˡE`J^BTH T̵SMv^⶙"eQ*Bl%2{QXv+lq)(sD4MD0?sƭ@c=*idx\5&:lLʉ$?-2w᷊Xl!H:+s"Gktw^ed[񃍲ݵEn ~In/M%?ƫfF/pn^Wk(_lYw-G¯mpVYyڇ,$āVˣˣM'Wϒ _@5P_0b-ɮ^cU Z1/1 NoQ<8~{Su=.О^N?9mv dV?h.Idm6JXrRW4 iE* I0AvSWMm—/%dۣ\H0vAT ת;IpQ%gӟ C/7Kr 3$8i.;koԄ?.Rm]_^H'kT ᝎ-X{vn*tfjֵj|:8>V)B#BRL$^Ar)%J* xu| UncWji(# ׳`sIsZEMsounWPj%$j IH\._]ẙ,,->b[r8l:ӷl|U%GK%}d}Ɣ `({jlRo尝- #yP Xd'w(MC׸*f-U2 \FvFH)u bFL$vu(99k}N߰4($(HއcTIvz) [awEB (saPJL!ӺJv#}#RdQZS& Tr p.VA#Nۉ"&#rZ$vH~,bRּT{~F:1Ҹ=iHqD\)u~ڸ:$ G"ţWGbC֒vSD[a2)gM(CZ:%غO^QkZ=jnt zU:ģڔi)gv8JCɊFQ=qOˆ)S Q498Jvg#I5uCMsg#Lt8\-JM-'i{R o\)N!W☊Ah= şWd SlC)sU]g%Gj\#W ~"Z=uސSH#zAQAs=i86Wgw MqvuԠ9 LsKDkdiy=i8nzSMbŸNg# bW RG)G=zH8D AOؤ6Cm(vJS$R:LJg5OНN=ސZ:jh~ g޸i=?z녳88Z=\8+ؤl)=飏@Mq {R zR~8PVR܃jVeCԴv_ٿW_”CjOM܁זgu>gAXӭnmwʫmg }bk#OPS=[ 82h_b N7خ,c7a, h??ĺ,1Mow=^>߉Y`WZlOu.U3nEn{D^J\*HqŰVڸΥ.OBwL>9d5|+]>2A15hbի~ƒv_:UE(Q0fC1\ŗ]Sana<}=2ғܜ|lxہ-T~U~n`ʡ-ڲbv)MA%%&$!Q29UKȱE[ǥfwmmۘM00a5txpi%˿O&5/)K,q&Wjr٤֑w[2GI~m]pv>'k^~_(AFAYO#,$Iޝ 13-"<) II}&)cN3MVDZk{5/x6s[Wry%)\u^9`S|Nۺ^wTX*[6O*Z4Z;R ~Up$d+ObLbј0}h~P1Q OA Ejӽڰ[; oՂ*.b8kd[RJ Pgu!$@EUub^QW U,2i{Xfi`xkL6B Mq#w)MbFRJN+}s#q Y=L RxMTS7)?.\O@2WŹƳdoblg՚˟ &%*O$ϹLz8HB$%J$ n8T\Vʿ6/ ئz}grv1ջ쵀dkMהJPP&}N4ĬCiU˩(i1&{uN*؛} U-Y9IS.%kg"8Nס )eT[S>F6c7=f\&6e 7;v:r)ˈtl$ $ӻ"[K{]$I(RvR!@ G&huT(&tu.Hyc[$r[\ jkOCIBJHlQ?R?OE渶fy.ÁM8Ҕ$FxMISVПWjs-ۄڔ./BlPAbb䛎uIɯmO^ЇRa_ݚȞ:SRnȏ iTjܷ7vX:O*=qq}?%kjٽ:H_BU*úWEtS8m_PEgW#X~لcuGȹ{9Yfl_l5-Ɛ'Sߟ &ot=E _1j.mUnsr=HDOC:jnMNSNActؖLˀe˯Z^8m ~Fl=*yz/<^k}|S0d $H+5SJ|d>X1gUݨu !"&M7+i'vۖ6n_Ɵc²~-Q[3WWLv-rBɰevÌ t:V˃bPt'1t}J(['5*ۏqܽeKW,X(PeEPIp *~ϪҜm=ͮ$$`SxP{L±5n~-9,2V@{Q>Bo֗Z"\6^` 햋ʮ m. Ǒ~~?]eR vڒ`_欏 Imd-l&1n.-Ұ N|6^jQğSD̘=.q!ZWcN aRP=XVڂ y:F*:KX=Pz{jh?!] Z=\Yi[G5wwQq Q2U,oh-eHFsn㍮U)T!&4sN VǠLZMb: ZTPGj`}~XEśu@JZLw8< @)@9nrۂٲ[J'sEy:J:^t>+C) )"A?Rтnl[j Jɻژ{ZTVP<ԫБ"!jdrtZ8Y-\jFpSji^B6TOIڽ[IsF­)y@cz>$ĮI6[qL9"J0Lw$0wQMN\6ƫx=s#$Zt!n qD´"Lx'NG' o4_?0,Hc;qiI=N[뵧QVod5}b-d>rGN+t<[$eqKL[s,K%ok0Kjx{n V؁ӝҔ c*U4r^v&ZEմC?RuqFOj$.ٽls(CKkpN4_?عAO*$DMqvT]KXa8Eqv.UN3JLNL,SY pURtgeO8={oi8e&f 1BYq|2$ORrym\xKt\E/)K0 mұ>\T.ܪdZN VfПJPxaJexӔn-<.^bM[CXZBJibG^(}Wɴ:S<6x5f76kMGJH=#XqQ̐Svߔ. 7ǟsw?*n98/_j!x$7([{;yF1ԖnkTv Iލi/hs2O̭|/zЭ:cdOnV{)|կ^XaHO q_c֊NDR;AugQkeK]֠α:rk#q!+Lj1.Vnݲ}[MZ#kqO:2;OO"6Y' jܸH<:;[>+3}>IѺH-ZQ.tąo;E\JN;ڽ'_Bs>HNaMx*ؽm>Kv (DqGfcW囚۟TSy*5]:\n:]ĎP&z+qog?eFZ]\b BK;;fneߺH$xKX:0"+w[Ԓ( ~76U쭽&o,,a~Ch<+Bd{,r.ݽEly6+ fZZ[pUktmb,Ѝ#{'GvҜjYJL $ 8.cʘXÍ:l(3 m@AYnsj%I} Eu+i`W edimn,=JQJ.\f%?I1Y6oz[K$$>2+CtnFI{ 9[X}vZiV'ڲ/&c ^iʖx&ahyֆʶRҹ*L7Nk֭qI8!|D|' W'*9yq__"oR!/rG ioaήiB H!`Jdă4#q)+N4"V/7|'OMTZwgGgff}#>sIB˵JBu2Z@ ԱuŋLһk<7(rTG_h8Si|;׮n)EK_)~x]1ckqǐP)TVFU'og|ww(Š-MTAUkN᭘n]^ xV [N8 )k(&u7IjúOR݃䖞1F{hmY*F~>ܚu>E:{VԹ& ŝ+<.Z^7UCFI;%NtR+K:e{%Ur[[[^_vrYM" ubؤK8R<&抆NN._.0 m~Pu$~5R)唓j1ʹ)zɑ޵PY"g$"[HA:X{)vҎr:]J %C LrM(>%_nbFm* Fwߥ(lZJ'#vɽAHmFl: Z=;Il*fK^RR$ о޽#Q~̚OYQ(vF\%;%@ kDG.`IGk;PBij?B#B{t$SX~#b}$K"?K`R&+G5 S8 \4zA~&a\);҈{ӾwoiH@TPJj"W!ҧj➙Gu ޺ģ΃uG#-VwJDtޣZGBO4VrSbGKbQ+<SOjr="^OA0K= 8b=M”78~4uۃqǠi?F Cn98W ~ڸCAOuuGE!ܞgK:F߇#Njn>"{TRȣd\ Xaj*/B LۦUϮ! 3ժz<t0YL^Z\$bhl;*XrrͭYZַ%vL/um%?iLD:OXAJ.Y)4R}5fq"=DzOD=Q 4 AOa=)H"EqH*=) A1 #pAڸ{ܞ4T)4SzS؊OczAO@\)"SԚAQRGڐSSMd)ښ#kUuvI-(LR g {5fSAOz㈖-eo;tuN4[iU~/pf,J fS;y{ WC/iiJ._õ=H''V-n.mĮEJm$’U% &IE7K_O-˒הBA5er96-Wqw)abttsiˣsGlƵФBSKW:F%XR:ߚD/7'btqíTq )i+IN${:l%Kk"U rrTxEM: =zMTri{^Ef q2)@oj"X!W0tјYdFE91l-6cGw>غQh+B GB%$ަ^~aP/XĤ)A:2jO7!/l5~0ܾӚaPO$֗|!Y'(9K~ϛN˟p Sjz> T*pu)7$B&-HO%#G~x>+=ⶴǵn9anO$kY摅9g.X+rڶ$d~޼Ӫ')MJ۔>zmޡiῌs.c%!+(P Lޱz5TOSsշ!~n~:dG0LJ '?h i~l:O9;?w$_Ex]H2 s=Ҽ#͒z3K}FG4_uW66xTӭ%e;() רt*7:@aJ?oOESJ_LX<6L =fź`RhGgO:KQ~,Z¾?4\QL> o5k]Cw-eG%r A^znHyB+/93\?? yxB{TZ FIzmZ!7jz|DUuC~#=!**8:aMw!I`|CroJ}5c"Ϡ jxK׏v!X82uۖa*B֝ެ>êvVӠufceE`6\5+VسbIҙHH.>B5v%s-eͲQОj»lD(8w6/؄$8q'ۭ5r-};U0o ']-B;IOAG?o85wjJ$M[c~R+̚Qb0.njxp,g1ymsj Fh'ۼn6#ή=<$+krK]d˶޸lBT5I LVS6Mz\Z$ MXEA;u o Xǯt^\K[[{Z;pF&h^I}L7q䬬6蔓X=6&Jm'W45-,k5_gh`RвT)gB&~MtR{%ERew| } ) T87O.rmKޕp+?|9~bnRIy$Jv*;֓!)Bj_"5ɏH6|z+,Y* % ۓDu0+:ݧ=ܜOaž!e bNxRLUYcl:jFoZ]pbͦPt'J8$t*i?߳MrL,qVB @1ѻ$ױcV}IF*I<׉%.Q ;lZ|Kwsn=UmCdlcjp˗JRN#JlD 1/$Rè)G])åd(]qwǣ5 ּ7 y.ԄD[dH;kE[!5kטPfZp!n ¶ܞ+5$ [~OBpd34ck嵣jne zF6'޳QJ2m2Da_FM[o wSrյ:mu! @(yK{ک%QFh$lv*ї1[SסH 0tITNZcưcZZN_Ve a )!)Dd@Ꮤob8CA/RI;m=莓[I:,nyELU"2,:^ ZG5TEGYL/!h۶IlpW&4P֐ oHNI QW g}á@J: {!G1D$R ߹PKMjLR; -l)I5d9ѿ㨯z< 'ږģn)?7qGi=I?9;YAlzCj3ֵ;Q3]G6$JЉ6j?JgQ,N r8  2k?R8舚k9zI4Jg9C.@a_6YMgڔi\q Q=k3IBC\q6R7IC;~j$hNoؤ88֐SilCliI5ŸFU&SR~A8oJu~W  ={Cs\)AO¸S 7#۽2SQݎ\Eq`bpn1޻7C nsZd/*I嶽ʍ'܎ο-%@D"? ~»/G,/qwΧHIңZ!{k<á*n#A~wD/0\oB\XD^b Zq:UjLqozVŲCZel(%d Ƿ▥'R' N_/ʬx6ȚN23LJOfI'UOK7|#$I>_8~:oquoӸNXĨiՐ =pE \qR?Bv9#H*?@\)8ߚAO@pڐS)H)1H-Q"S)=~Mp R :Ri[ tqM+4JBIvyPcrg@IB.׷.O'^qqzMTj; I7B^n:Im[Kw&CE:RhºYM/vӴC>Uاql~ hiGZOA޼$c˫׏[EZ"8e[n= W#JPnvEpӸ͈5pEjLI"&X\gܑM=y,9ki2RSz|1цMQ!MmjH-*KhVI~C[9 .QdV]=m+Q&+VoT^>xkV|˘[v-S(.Lz NKo ]EnԾqz9em2p̸v)~Yq7 E\zdo,p %T5qzGRZn=Rr['@MX*Qh4)9'r`U/8K.M:Wfemd!-J\ۭcQ>vIбRS x`vmE-Jm SI㍭KSI_.L?B̟FŖsMź&)OOcNj;`^z?6?RWy']mm\|jz{Yc|8綣$^~%9%]bX]YZ"TI$C=SIvJhGJlp*lt_gQOJx/`Ҽw䥦*.)9ׯǞmQ γIo}{. cZy+Kۅ * =DB=9eKV c88;MPxwowWCxcV\7a}{DiXneM\R뽫TR^gǛ˘5%jp0I?)Z]|4$*<_+8*M \)J|x5Og$oo]~+RKd332~t =ڷ]'S q5i t1\1.yYws~JvVXmؤTNMJ=)(Q|8N< ̷Im݊Q1dCl QYN`u=OdJ)bӫS{:|Wjd GR{c&Wen, :Cc<$HQPtp]F6ԣ2v?Edk.:QB:շw[fZGfY2a}44 aGJzjOt}M+!,i0%ҝ /_&sZMcԁG w} !B@u?gGzvm-=Ns/1%cW`)RRU1[UGY ӻ}j Ĥfc-y)7ewKKM:EKge) $aDv1U(< FD 0b/X(P&0;qANc<`ƂTV=%,bMI21#ƌ9Klyz@tƮN Vϱ_u^ŗpVOY8wEdz}.=vO%2>eF Pw}><}f$熕4ƻOa'x)qՃw.D*"@;4/%tTwkC/ rYI* -R7Jz~8bMZk1x1O 1c(ZN(yƴ:u=(9.[+uN“iVKO1,f42Mܸ1VHrvԝ$Y2k;i'o ZGe<;Yp-2w@):\5FqͱZ*{|ל-tbإa^p:؄LT]W]%&խ[ җf91 ZB5nNt~e%.%+Q;U{n t+oWs&Y^ݬmfp#ʹJcƗi5d\K[q*o V1E[~8M⯂LO_m`pR>M[kOv#xc. E&R*:fUZ{127[zC00`8 "-dTgc++v>&=4)'`[֭,޲ $ǥ`nS2zMf,7cu%l׆љ0ق63^4Ƅ)xC;b:5a?KV5;;GR4'}(.PZuD) SrKZutJcEu?F.l>KR)(("&SiO0nMSlSl\]Ը$ wR¾7vE1nQ>kGHe,; 5>^8,nKjW̗gdi# ZR@ߵ\嗖-0vԝ4>?k꾄c5yeig~"l8eHdP'ҳ~??$aiUoMo~9'xI-[ڤ4#e!CevUgU駡 sc|6b09}zSe)B} Nvu%RT%C`2aG$`VPM*HR 4NZz~3\qW{~yJ!gHJq++&<`R?|^In)br)Kij+ևbOs_/p7&hOpuN^} zhHtY`ko쒍l0Wqc6EZn\x0HhW,[55[Q9 Q(304OrOȼPIi/O=˩A~Z֞t+c-I?S%(mz3{ӘzAz H) C?v5{SH)\)5 ~M\q오1\gH)m 4~+=ĊAO@AOU")GSGzž ):h=%ܕRP?K?x8 +=E4y @oH*= Ǹ8\)SM KRO ]brEX5'L=M1%LGy;IیMm*Ą#n?M͑b%[{+<|YWy~IuaEj)'2yۄ[/qT)+zj|{,`[6%[rE)`JA!)<XCV65&I~쒆n'QO8eeL4Zjmʒ؎IۑZ*J*Y)×{peDL#kۥ`w_[uP o*iumE⽟F{᥵!h ۲uH^?׉åR%&Zc\8]x*Q77*.D-3Eۿw;z]d2%:%d(*F'ՏwYŖY%QkOM(?>'-K$֘ӋuyG4n, ɷWnKz“3<*?&hƲZKU}: sq|f7Tq&k+Jo0׎7}2|.ݦa '`@Y^H}>A1n]E*-L~ƽpxMMmNjS{*S[. /1fd1k)Q0= ~;J3fnwofdzsN˘{ZG ))Ԃv0ht94WC֬/6~>N~UHB>YNЮe$`jFj V;E8Rب'MesOo]שg(}_2of  3 u*UaRxJtΈSD7o#SeX^TnGZ[>3wa,w-^JujH֗N^]<߳T(Q Aļ\qvo% @K#1iMwDmjf̓LR}Mun3TSLȴ=z32[!֊U\Zb孍!OKg,a,VIԩ jY~xsK:4(A'Ҡ5-}{#]8i`Z6VUWʔV-$-yt)%pAGpo(p_0۷,%<-hrcB sI 75/ٜٛ3H.2l[zS+Otڢ:׊Kq1×qek*}cRR )Gt{:,05N.Wӷcǿ-|-qfȍ l5IK6|ni7\[xT8(\|ݺ-+Ab'o~5gx.ZKYqz&+rÂ>[22vkoiyI l%NM*rYǝ*m3;EWX:W'rK}7Cbv e-ОPvړ,j[-}5 8蓩J h|ҟ7̟5[UaX?e 6>JrvOZw {/+lN`Djhf{ڲs}Wn06pp\l~;omdOekTˤ[) wGXR!N T S/Jԩ!uYAgսu$wMͤqMCn #3˨l$|Ê(:'QThP&= /i<+cf,!Xy&9;+ k??bģ Wp*?i?J}gJ!Lr)?cq~+ۭqLuWY D|G1޸$~=\GJ!49+?R F%gjKw84-EpڐV~qz??@k?@$Wp-Y=},?y8S S6q4~}=SpQ6ZA=ipk?x\)ҸCqQ+=82+5W{iI$l:TdxVJ 3?7yլ(BdƱ .&_3 TUJ>͇PJy>c}:`-EAfRBttQjFK{N v^)QkD<^k_ iiNNJur^Ӹj ^ 7'2"Ѱ{QZb+ت2'nnm^G=3U\nH4loral_(y֣*&xDWO~gOs~$4_mN_f2߅9_ϙ޿KXCi)=Iɚ/N5r1|#sVW^|s 1zݨi Sm#B~^OoӚI'{-qaҚ]usfZen>ZzG1^7NjujiOV|fp[L.2ҦG.Ix߉x 3 5oKئvg&M)?nk`%T$qZ+MzQ/xa,˱ƝB-&ѰKÓ8)M߿j$y\p-xz˩qIJ]i!Q:1g&l>Vu'\+EaIKN )҄(EjzΊ=dTge~}Av?i]=O%8fۨ5-=<ƿpvg? f lXt.6R $^בܣz~{[.5zq^:: XQIH#pE:QC["k7sN0FxIyk/,=W+4nQK-{ZEia`4<<O=?w. X2pȝڡ<>Sۮ쏟YŲp4ٴ|ޝ!1-}~0&>ṫIR)Jq[n_<6)\cٱboK}N#mG˭Kғ򦪩S5vLbHJmۑU~%-wL|PQCF{PʒVD^~3e\/".E1r ,$}RVx֝lN-%A|Lg't=|Hmdi)Cw||Ąw2^ VZ`i $QU=S7' ^ `i"$Vi>gXY]M%[ *'<<\Tz78x11 U70>Suus*ۨRǎJYZu{i.Yٵ)zMc\+\W+8Et$e-n;v7ih7 ҘQ6EVx)J 9IE Wg6>t'ﬖ A thf7tCuSNQ{^{/2̸zq w Bg#OMn_ԟcV~?H3f5ؘ6Ϥ T4ii?d*'􄑸"} 64J Ǒ?~'|!U\&zsv?:_eүvC|3e&i?Tq)؇{ԲMM.IIsVz7ZeN-}@'N92n)y'X3}{X"?a8wdE!!RD I}V0VW;n+UH®[-&A cIz?)>RinY2ȎS-۩cO]b1ݒ_+ uH8{aHիjtF˃-+@}ԆTΠvj6H?* c5S`R |4cY-S?1 `/Qi#8q-:בApM;қI~+u߼1U?Mѻ'^jKc[=1TQS^kzѽ'/+m&ȝL?$Ҳ~*ln|@9[ſMij=3߲4RH|:Yj>_ fbWB%I (x*Ȯ._za#OЄp'gү'DR\զuN֋:_)Kݔ#;j;,\6۫vܒO#KX|y3yC~-O)a^|;|5Ѿʞ*mq\*g)D),TzOBS4zHAOBS &&S&w4ސSW zC`;= ~H)\r=H9&GAhԇ#$\- =)Ci!ǮžjAOsH-?E )=+J&ɓW"؎:uM  j慗N: 5Y/spmߩ7rNOr*[V?? ~%ñY^Ki!BI X$(|8"?'gxu&rO~Y㌒\WVE:8?(|kʂ¥,_U::.,ϥF;ţXR *L5csM}iW%IZDS|ÚnѡR0U'Qt,do,2H>/3n-LIGZ\VHպ ϣѹÓ,/yT]?tk<#.jՖ/U{$9JRt |ʘ WhY, 3"v",c)9h=7i?Uw0Mk7.`<Bq5!⊚r7;8IoE|W.>B#ƥ$0EM5$ob%R .a`B6VK|EH) G5 h[D%:v j37#Y츝&Yy&q(8ˉ{rnm}lxo|m u%&0ڦV)5'&ljqj׵I׽?i1lpo<K N~qUa]{QIE%_ild_7ȓ5~C͆W޲m5'cVVDhz EkRSB{(sزb)ˆV,FLESb=m [ 49e \X+Bδ'13_~crR]0cj/W(3~s  SmmҁK7wH7u~1 M˖R)w}2opK{V B`0D}ף\۔Rq=5vhOjKkW"㖟YK;"qSΩ'X$\jQn J~q-N[P#i 9:x)8$Uy>;xGG.7Ne.+/N r.RmJ>ZWΫӋM+urU|qEaVK8VD;Ȭ 3Pk⋗ԝuiL19gÌ+2APTȗB'PHzHO]>4Ҟ񓵻>^s-rZ|evK.l>v;{c[{7X3\3y80%6Rӱ3U[N 6~׻-,B]0\Vg޲$ӷ6;c,;$aƮ%maQ=ը:IE7&5mǫ'm^{4/yl8Bz7<7W,sk+ Ep6[?o.\c4b7x%>Y,䔮jҍ L-r]Si_|k1EbF̓˦D\}7!~e\wAu:Y*@TRC7GW~w|ܧ`^(e`ݚ!:TBAk%2o`+/KV*{> ՃxAsu[$;~1AgrZ1T*ˉ/3% tMV q))܄ T2P>_$'{3owa7"1LXn񰎻2o{vUbIХp#;UB#3iz5{9*^<{/ H_ ўaWO*ҕJ}*W8>#E-2CL67nY[˖wRONvBz՗A,Iջ{k}B3.v}/ -18q.Au&}'4V0'ӲIV V ._q[u_yqxTtKA!-:V~du"Ȩ_,`谶{ 4ky}/T5R`T]_FxmiOt/k|QV6 ]\Uͭi%%:eSW;q&} lN%z-[uH;!m7ǫ[{r/9eM߶v(Z` Sx|1TQID6Sy7#xHҢ8ZI Ae2O"k\.Hضp;c|Z}(RFfjüK^n|ըo\miWb$,'0-Ԣ1Ҕ"w$AZ/-V’ZSC;*<|1x[:[!`ޢ͑o:;"ag ­p|5n?f+@*܂'~ҟy`6Jn_=Ճ3cOr: = <Ѭ{/CT58aNBӒ8MCΐB܍.n {:BFLmODr=^ bLXy ڢl!:J]q)$zc {ZPҤg'1 ?|ݝIuZc)*;`h<(NT$ZO$J1Kv'Ly?H1֔oF՞DuuQYܞW~i]bG>uX?tJK]b[9##޹5ܝţ6:; ~3Pʺ!<ҝg?9iy=i%GR;H?\" 􍫎=$o452b?R9/%Gnz[=i?cj\%#jO;u=:i"78AV~ T~AJVz 4f oY81#S\nIlr]Tw?ު')[}0JIRQxݚRT6Y%Ly.sfDbUj|.} w[Z^ն@!p@ީ:$}#Xiucoeɭ綉{GIxcl㏧fhz?$m"/c78u&i,S&O@OjQLR ~Hq: ~AOcڒYH-E%ة  z)]b]gQHiE4w?@ڸ 1Hq^O\W H)7QO[N=i q4SЃ\)W z@mH)"SRX{R " '#.!qN_=Ǽb]6H#y2W7/`8<VVsuhVܫerv? u~9e.IjWIsԭ$|ȌC:R>3T/N(M%;Wsʜ|eⷍ[](k)? zz~іJ1'8[c؞#:- IxEcn.-Ap `KYTu[{]ꊬDԜSipd̓#oD Jv6J\PF}WW/(N4BLSћ]sι(q֟ABHǂ+=+8֕(+vl^hPw.;b"!_:-?t51V]eh# J~~H*=!ǡžyH֠L X ab걏4  Vsĺ7J+wv)^1ђh¿/koDAґxExoM8kɑjz_ƪ+[Km߸Qt8 RCd(]w%׫88qgb!kl+&zY3ArX2nbռd%R x^WI(:uOR6y/6wij)J`E`7z Zԩ8Ͷ||r\SW~6b!\kAX -gӵl?$#>n]-[!͓JM|rn}K@>)> Jfrt׭v~ On5P,4%V`oOi<1jKWVU:{'NJpW0py(rLVCq.Xwm "UI[%J,T F$AC~K%"Sm{6c)eE; ` 1}*:/#š[y ?7+)]so2v^oT6uOR륅|-ioJe%kdrV?5M,qv ɮ'n!w ZeP@m ީp:H Kk}HSzt^mwk5(\ch.J v3^X%'8/Ӈ iL,3#e%+ [ZP H&Ⲟ5cpkL{?o>MPߕ ʞ2dg .3t!xj,!"V^1FIΛ}<;7 k* nE$zHmȫ)Sճ J!JZaT2cHjNI$_I+xڸ1|W-m%PCi 7Q}ˋZr-ooW{eO#,S|?\i.'yjTbyTt $Rike;;rvpP>W*L ӇeRTƯpqUq}n҆ۯ \_>mIY;9F ;RNrF x61k{5gIgck1tD>k-KNݰ[*$~ ֵ^zpN Up/rzijؾAq!'pG)#b bc]F+SKI@_B/5$qӌJeI'@6&M`,mJ?_Qn;2/}-GRUʠ޲,NmկW>6>b9l.VSjNckc>M6ԓ[^NT;cL8q<1ka Q Qtq "bW2;1upRWهGPzTX'|mA}9xNqNJ \PxlZ1]m`ѸCܥW,bCB´`tt6V&i@WNowĜ{VZr8"!#= SY>I/d_$VrLRVLڸ8n#;UׇYW=dz%ծKliO\m-ƒ依$Vw5ˆ8r_27 <)EPC`FI>;EV~7cYE/fsv&w&pLoqIUM4fd,&\a JQHcniI'\2WW68bC1UgItj;~Q#O?̡Ԃҗs23zԞZ~ }JY&d&+GMKcal{mmIa ਅ$un=Q}j#M>8yk}<;)m"9Kc(l]-p]&.%[9j8JDI~>U/%Ŝ3d} ^i)SIK&t~۷a,Zl%?WН| *W9ڬpBX,qd]w YuR.V" r:P\ZY8;B:JHI}j밒V]x3sƆ[ʷl6muwq{NTI*:F槎[]ly񗰗Tr( mex"FǨޒy̏GO󿂸X~#}U.8S9lQ8nv5mn-(ROJzt#B>l &M)|iPRœIoҗRJ~dl )L!^}EσՆ˒v⻍VjDzF(-څefmY*$Iyiohly9HQy[I]HW.bP6_ jYjt^EIS|&V07R}^'n.5[PtvaE\RȐi:l6i4sS+&NӠXʘ̜M6֮!Dj_+\_+blܝ>!,5#lŗ~:7mA$=\Kn/z)7F_ad,)𫮻^S8'Oq<)!<ǹ/4u˥k#'wXko&8ڔ_ѯE/}&mт:QO1Y#iw},ƹ,ms{k["DuץP6ihc 8Wz)AY\*G8>£OZAh\*=@M4V{r=R gM7zڐSЊTڸ CMgw^ƐEpH)ȥ84SE \)4q=WzЮ9\5dҝuZR$ltE|ŝa]TVyLe.R)JjAT<*8g.6p$.TtS3[3v .n]2t2xmIJedwm˂ҕc̸-$رcfob<)Uqt4:oߴ;5*d/roKl-㭸XTnHX`G$PbSR~^UϖŪ\@ب,Gw$w<7M?:_/XNgt19Ƽ&lo6 ؍FM'09lu݋rWpif4ڗn@O%>޴ټu׺yY 1ay>(؇HGֈ<_u9YxUθkXN-pke'Y$-ВT\gY[PIiNo5ڽ4E[غqyC,4TH߀V>e21m8Džm/x|lIA>>*tyVG^[B{}2빧^ F*A@=:Nu8v&wH <RW%)[czxEO;RղiziX֙=5l/1tvgP*?ɒ$0IT8zIܜo~dXzY ÅI(@IGڐyuI8~TԞ|J +gBͤک9"?s钒|Lf'vZ[)2T7TWTc[TDoAxu2- y>Zv7W1]JxkM~wR"Yg`wBݛӯ(H3& NEU`J\{lt㗆Mcql*qch p&:tڝ1>V7ͬ\%$ oaS:.QdOKBcbo~"OyɥS'j4%@v*קUGлW Z[~^Nxai)7l>.,Pʇ ǝh9UUJR_*thQ2a%}k7|_/J\QG~ϴqV]wD֛i;uj_L ]޹p2!TDčҮ96>|K |C>6x~Ro&iiM&)3:"'}IJL_.ZҵޟLL gpߒ`6L3 =$t_ᶭpC8/Q{XREBd L_.j7̀okVlJzӸz]N=ޓ,Z˟N~~-Ri+ߙvrC1gfL5\$GsQNIm$ ^$xKF.`>03IَխНD'H)6ۚu>-.Mn"={gӊ=|e˫nkY.f RNd*[{ӳ۷-/61qpLY',5(-!Ip(A\7=MIƸ[J 7OJ6 tcZiyWmn˥] ҡ@(A1Ȫivuӱ lQx%dTJVܓ$x_ zٯ$iC=A]7 ȉ1L\w(i&1IV{) luuħ4<#le  6zIZv",.0MtU&.WQ\0|yn)!.hAD感W j $밚S0r#r#i IjU(ۭz;$[޷ɘ>)7w#-\ RI=RƵpnJe[ПA1R =iK:㹤"w(+p+=~ R GFJ"<{ jK{҉GxcӬJ=%")Mqǭ3\uNԇ##)}ԇQFŪ?Σ&Oz-Ƹڸ? vڸJ?b(ABG9Eqǭ=?A#޸J?RzR?j7\!$|)L GГq#ccz=F߅ D4'jhtѴhHޤ#g2c?Ҝz< Cf+?tLm\ةC K=e*C|@s>Xonƃ^_$v^R۽dJF*P(7+ nRJj{2 2탍]!ߥw㖥ʪ)50ȥȋa ݩQ ' Ү_ uf6:x: b$ 5`& ~ .Rǯ~qFz ސTsY1##9Q:Ax?@ {zSR {\= M !Si==4caH-Tbq$R~H*=\) h `R GOA$R {Cخk:E% 'f5fƬZ NxlrŞ$$?T+Y0%ko/e~ﰸܽ6_0_ϹFݸ Y>AǎǗ88$5Z^x^ .KU}gls },Al~$Z_ 0h_a)5WPku$-ŗG-\AKJ H;?"1[PnQn2ǦOW~ CWV %tR@ECIEvn$/#10P?K]x[x"Kxz&W5KqtԵ$r\9<[[RF^g Qes7&H>sxdc9UKmU-qffVC UKQQ:ue0,/.Wn! #cW<^_EJEOj[5`|*唲4qD2~[ɮu4R>߳+zewe~'bD),&;Q>;TVIc޿Kf:'~J񜳛zu$ȟB-}<ް3Î\cg@mxxm>7Jw}ITJ ( 7xI6;kܯө~|Loū7δ R[(N߷[uӎMF=у|k5͸ hjL 'wc'YFYz~n.Ϩ6::mu{׭zEqw-'i]HmgI h<v>mIӧm)'m+|ŶR""G^OIU|ǵ;۹8>  RZmF5?=kj\^ baX!8t}'nA~RmN r`1rvk)0;GvIaȩB-34}%`9԰_>jFkYKIk^Z¥ȎjpȨ<Ƽ1en/γ^I2#\q>J\lSh"'9+2Jҭ35/ \qPdi zEOOֱ#Ѹ*8 Ԭy޳zʹZWDHnU0:^w }vO~^oR-nVف;S˧wvvWĭ(ܸX9 S~a7@QRO ޗJkO(W>vhMXN }7E`i\ǫuPYV 3k.c7_]mH@N6*/(yeF1,fq|*E5:II2I:կGCs2L\&_ޭٽRYZSJ`XⓤjwQp3)/P|.pxò 1w.iT:@=:sU{AԇpԔ~SBZ DMH2I{IC8d-Q?3כ0̿!L/q5%HQh=ccEç/JVdNvnOW燯)ku@'[/vTƵU-<_܉Kf hxBbJ*_zFhۯKtMUdecse.8[C`' lGQ{>BQ_Eߦ+YLK#<8x ;90t},G_+-JiwmƬRT0> 79 Pk˫gq(I=PH\6=J,>:ַ֭)ݽa9#Idu{[b?C0RA9޼^eMӨKЂ%>'J#H06ڣ KJʉ=!)Q+%Q%Ǭl>5, ;W@8xxN^Mܷt BjꞛOB]%}fl'kc{6uRsD I:!vezSZ̘LvuQw34CSCI'K!"Z[fTg'eyW@DYf bvBnyV?u;H †we}uG.0 kvf?@ސq!ǠzOzdsH+?\q#BLRg+=DAOA&)GzO@u:q+DZDGƸC{G=R?vu b# AQ+= Hq )\))= qQڸR {zAHeMcRB}@`p>ɭ{ )=xZ|FY-RȪO|~' 85w_'ŕ{nH9z)䲔 b,x?MReF~+mQ}nV%*A[Ք_^ Xx BSqnVFRFx#ޒ=f9bR\?FOR]Q G?W/R|H(Iۯơ3UbRKjxs]?y)|?;eP< lScNh8ҥN2!^ -);A grKjOTuͽd@}n^)A:>8J'n wLy|طin~x]1˸'/N+ߥ{GGᘺ)9oe/{{RyeWLpǖo0llieT~\M\̴4_ o@ѓ_5F^PHSN^o.,*._-ꔖz! "IN +*_/Uઓ7tBr ~+nH.Zu:*6u)eQQ=QWkK+ὯAOaj֗=·Gcm'mo@NeA3X2A8=q^E}1qIcSŻ跳}oSn韼d<c]LP8$zVcT(=3mN-[f(HXbyi5Zv+nF@;w ŭkUI#pAA:TiA׺ 9/s9S8\*䆰Mu¸ YϗVi)W_\>㎾6}_6b8 ➥cZRT`W7Go#6QUVDߢlVYhI?5(Z?n]i ;Rc¼XXf Y$)RWQʯ)7 |ǭ]ѥI ]$j5]-Rz[TI} sM;r)Qq(0B&Riay2ڒU.~;xPl~^s*qJ]&6 j'䕸I&Y^fnkcnT&:zinDB#مo9p$P'zcjk*`Eu5x)I)QP̔ϥJ#cQ=wwTX$g-漉f[\AQ9Z 7VE I(;O38ʻ~$/]7X%GJ\T{*Slzwq}jtQ+L~LzF5{ƔJPzSDxwSlqJ|Z[:ʉ';oyb01VͭOV-,ח(4:ʡ@$TJI C$={tV=4וݯiG#xuKOGؖkf_8'v$6ؽ(BF5|> guS!G*\\8;+i%Ђݓ)7/&lД@DPz~luZGFsRy[iu HRT we8<9p2Z=%4_ 6Ȃ"%=#/79KnBˠe"wksx~4(1ەdi$mv}ZOQI$n| OiV+]&Іm, PudRtmބǪͦ_ ﻗ 课C.e[3s7m4EŭR P/BIkr?\x?a9t*SJN }s1b\Ǎ=LXt:V~t>9i e;(6؎⏌5f&aO_ ]_8P'bV`)F+镴1*R#,S*奌18s EJV$n;Qx5'OЊT@vG8\⏼_1Ch `t~,Uqicų~y[y}H t(8JkK%p} orn2UBn晀#5.NQͅsZfNF_xfim(SkC9U=C0JGYZ7 ڡ5&MNJplG+/ʗ2 -IBU@իz{ӱJ`Yvut-P b;6eIr778"] HRz+D_WkJ1#?d_.oݸq=%Ht"¢ew;V=)B$u8yH$A&J5&:TV3ҢJੁ4>K5]"f!Ё֝ƄNJ楾ܿXoZlA*Y_6VGs&$>&{FOVpăF{5Yz&1/yϙ!L:>&]K'/3ȃ/@FsCˠ.G1XJW+BDRolփ¬qQAOP#SY=#Մ)~)Th;`)u]@n/O,v+!LF#Jӱ/毆tGY+q֮z.u1.-!;CVFcq\qRxR)H:unTNRZ+TgE1='Y65tJ𭕴H $:-ai|k9L#S@?rxۑ;Lvo4/ۭJBvV4|yxr|jۦ5>v-xIx&O>G?#tqGa4=t4 MeP9?*#EWv7"Cj;އKk>u]-t/Ԗ3IKgQXO%H=#[kbS]vj)5P?CfPO+D5 4.ji%?Kz]6r[`qNLQԄzuI4r:tczE ƚuƀ)FU8&" (8 _RN;'+\؆Rպ2aZjfݲcn͛t +n#՘O؟Ÿ_xmܨ+q&zUWd}Wa8U VdǺ#-+…Q2%}-0I}Q˸znS'cYNJYucCIcbɿENꝤP` .^PH̥QEXeAiY^H6_ᔚg_𹨌x&ձU'cʛvD. O` K?R;*|4a6t"g}}MzXێnZHڸDq%B[lxWQ,U(ÝxQ8"vn[ig@=uW?@҂z(#TJVqwQu' 8uWR$d&%Y |IE.>%_4;Tb!t s̸mMSN0wlpf|41ړh~>.51˜b빵R( -Ke<$G;*e[ؾưHԕ$G翽nv[aQZzrf.\[ۨ!E G(߸#E#KH!r+V*R1v EL ' [pJQ JG@麇r׶+22V ᭻ Ðbrb8JQG& 8p8+qb"0Q q2w- Ŝ:WQOi HX:COf/l+L>i.Ph}lTcI&''|Wi+/Lqͳ):qGp7"5^A،yEԣ<># VSLBX͵cLPt:{~>>*#;!52w %7X&(rOE$RN]է^A{Չ`WOyZ;+Gr$wu8||jVY?G sIXiL:@2=bRWb<fllP~ị4PoZ;DK;uq;i7F -~l~>u_Ǖ rKUn r#x )t;6Q$A'X7΋u[QCbw7WF^̮|Q>9G1?/d2,A(eiNXqOy=mE˜̡꺷-ۼL+TyA'=):z y̎6BC(T6C'W(&߳]ГĦRo"yAIm mPJePO2y=(J-я;GJkn/Uz~o>NO˫sZ]q/!6WlշꉔL twlWԊPOjaMa%AZ[:’IllIEf~IяI Ŷh_ԴIDt pO~?q' v˺.5֡HqȠ0'e= YX8WO-jq*!zǏjȄ[أVba\9|uũ^'?6Def(7j0V5k/u$[!!9:gH±$WZAIQQBl:JxL'5~Z_=( =h㴈 Ք-|9-ߢvIu$|K Vhb-M8ɿūGFzxD&Y!j/[@RR\WXFGغZRA5 Dɍ`&څ/d@cⅸ`y.igҐՉ *^{vOȹC*z`:r7l?:G=(nq.-c'{"\y*C)$}Dz|*Y; RUU%O!Dz2{I7'0~i9R"H=MBAQtRhU0(ORlЧ\*I?^sxV8lh0`X, wz[IIv1ҕ:UM*WW< ԮzWk!+͉,D5)'FI waUXT#T4$oߪi>){GH$ T|^}4^ujvv^~(:Rz{c)>?-j{a0t{-عD-0G5 A?j&mZ V1 +O+K0▶PZh|rLࡁhTt1rEӶDs lH3x\nIH6).o4\6vN~*GHQŶRĶ+AVۀhL)%% 8sZ檞_3.REn ix˶{ly!ŋCMfPzuLƗyLqiBdߠ%ME:s\i[;TSlW"ۯ_< n5# nFc&̷V7uJ˫ 6%DʣqZL}t\Sl X7$6ݥⴥBh}J2C4*u +Sh4ꔑҚ9ltDu g@5SGA5¤{䟾{֒ţ6xOIQ#U6iš=iT<*K!ҏ E*c9N#g4Yj>vb?I: 2iFb s!dM)rJIVJtODVSy~CM*UjX_ - 4X[%*N[@" '*0,-I5i yd$Q"|Ou*8aH wΏs:bqbNsSuy$6}9A( P.FOW}:iAWb)z eX®ԙ=9aWsG-*.8 5\7ʾ.=bhJ "Iu/H9˃n>4D$w'.ut!M½28ˍd[ ŕ7cwiI.3Sˋ~ *&yohu)Fd}o ^SCqgSQk.P~UK=Q$Ω(cq4АkCmHp~zE zߘ;КA:A&QR Ԋ[?R$ {)Ю ]B{qǪhz"Sww{CbtgO8pi4W\W {\q)=ihq zMsSN=EpHq)\q8pH)ҕ撄: ~kplimZ!+YYm5ҖDt8nJ\BT!Bij)ty7lՒԈTI&xީq=;}̄7qx" }i%Jvp&Rv?k}v.xd,or/]P]' 4H):!I&5+޹oÒ:P7#5'.\a)y!!+C2%b 2ɒ. vC%*Ҳ%ܳIpi2@x#`qNx5S^8ZdilgpХ_.|[ {(w{؊릺٭5-"#^UʻđlH`pgrLVC< D:#cmmq)zH姐"R~ȃ@bXnIPԈT:TL4OEYz5ծ[ɑKSI?3^Jz<Շ.pˍy6RJAfrOyK?ZLt8qRNA# 1 чJ1%vb /[!aM$.yN8UH(k{5Ev!Cߏφ=DnO-itg~WJRѦ :GPzxZOӸ,|gn~6R)!\k)wğxoSE6ż'^+C X5#}IG|0<Ʊ̝[wc~WʠA_x}oܸpRS.GHPV/VQ?_a-إç&xm p@~o {Bk~ :Pk;.\vob(,ߣ0u1\ A&f7ojL\-z~"G,ʹvw zdu|9>+j7|>Tx3;֫?uno~D6 Ԝ}JOі/ Uzﻮe>c!y1Ɛl)1Y?(Snl/|rD(XY'=iCJ-%SɹG 4c!s7o2+/ǜyY#)2'oxEVLȘl=9.^kJ&xMieh,U5FI(@SI^)rŶ#l$I䱝IQTgxJ'p$~Z1m?fSyZ\xm8\mJ`Dked|G(Fz 5ԆCN;z0~;nšd $b4GZ"젘Ժ%VA6 VP_@1Qfu OլQRN-wE̎¢* aRO8JxjH;9QJOqIf8bBIj.`)ıC)R6%. sp+C !6Oa(nA;GclOqo^Juj>]lo-j*6^6p3Krcjp[E>\*MR MNa Wc NCkeL/~wϒXҮ-4p:`VA&z⊼+B[^&A:hi,lEK" ީ<z~rރeݭ.Tf|6\vu(HOEejrR< RxyjOqI%h|mm6̮7* qD zH-R1R?BHGH)k: z^qH8Wz`MpÎS+S"H#ޚ)+Yq7zz8H) Q AO)G@AǤ{H)&ΣLX{ Zi,Z?b)=Epz\qM6ţ֚@E!ǨŸHq AOBS\)Rg+?E!ǺAObSR`W W~ cx͊-.i=V`jl1Oyp9@.~&+8 T>$XAC# rNbWӭN~jMMrv~ﰩerI:?~"ujI;w޼?*3,1 =7$)꾡X:d֫t2z2-2:,S$nR"}3)sep/w:m0V&ÌR䬙~vEb_ ?J̢ҭXq I.Еz쉖 3q_g+\l|m6 H1YU UdUI{z~!c[VaTR uLg.SN_g\|ǕlE/2}U؃;CT%~W-8~Nw/$$;Е.!y8R݋օۭ-mJgS,Hɢo->5PI.% >6(,>?-dYOxpom']SN6GC;ѾWxBwD_aӈ+K%$ }s&D7\W~# }e źH@~ W=d*15*Fn#_(A0y|ipD}vAkb}Di;g%ܸɏxa*Ͳ:*HMIq%bɃg콃*ٖ@ إC~}=ivrgh=(b<ܱ A.YO3Bg=|QbƐDɖ;f1 5d ROYȝN2yns zRTwIOR0!|emmTB  nk⤈I!G+/TA@etnСuuíAĶ:HV Mk}+RU4Q^Ѭ91**KV4,zm_KW(Ͽ yc'M{IKbSjTxTC!yr޿9E_|l+jr?88:`Xԩecg+x ][n-yuHJ~q)'Vw[rMڤ8 a#?IqVK^rc3\ͳ+u'O.[X%Ni{bהu6'I;HϽZxS&jk]S~A|7i`B$oI7~Jte0mZ햠.ڒd S.qWd|БmJ?3fSc0Zב#b$nSlFVcĺ7?5'?9m,<8¼ovن^* zF=@fxׇԤ{I{ 7RcgCiY)`*656j?3n9̓p$N${LQ;eܷYr6HʌJO@ eC܎#zNse$l*he5+cRnq0liQIAQQ}_/|BkmE<>m9EWo6EW]ڵO iB[PRG'dZ˯7,wT{gn[ [aCL@@QɃ3TY&Ÿe=fR۳nEbHnD{Y/wVg+MmG(/LMD"B$j4m:ƃ~pI4IT{m!B,|R¡ˤHމL䇫M)'ShBvӵd:S8Gh ?GXQ=%;asA}x'UE6~J[^KLG^P#ې{ĮEfU>V:)/k<(A-c`| .m}vѸ;$|x~nlZrXDxqkˌ.Z:s`({r KGϨvi% dћ6*6ڴQ,w{t 8H*'e(R U 1| Z%GȚV"}4byX`]?/bi\d^L4nNܹ!:ʺ`ZXV?UK".aS7DB*lUK~WO p6 :R ~8)HSH:؊)Bk?cO@NԂ!ǽ3\)H:P+= £IVsH) ʄuDWՔԩ#N"?]$m oLJӉyD&v5M[;$4;z:ȬH)$j'H޸qéH) =iCQH8Ib%G]gQSMp!Ǡ+?bS"R~ zЮHqR z9'!ǸkC)f[;7iĨA6#zsimF+vۥ_17|ń13L.ݵAʗGǁxǍ$+M7qpO27e<.qNa6 $tL_ivZ/,[lg/.+)|;jT#/dztV稑1.wt/O8bm j.y"QE6(G}7VK 0K{d_|G Ve[S?uˉn&diT櫁^$b lׅR%/ %T}mOz-Y#.9iߤ&Jx;>!UyF#60VKwhz^l_$;PpˬQЄ *GjVMmrS-Ish/=6}H*-L᝖-ěpy#PH;UN>XucL!ZH$|kC D_.r>wEl&W|Iꍮ߫,3+`ˈ ΦJ#pjNZT-Q¬txB%'S֨"42N{2 ;As1;ϸk R?*MP3x km,u•s@UE7&r,h a%`j#b~1^ r$᭘~QGJ͟RFq@﹎9LZUqPݜʘ"^r(P /)c\44׉6XuDR uHޣ|cUbM&`O?טVwW"=&6WX;S/\˖&GpL8[46@ѷIJC=jE5h_{Ǽ?t$T']s*Cū~ܧZ:ڲS1ፕ\Pg3)Tۚ__D<.Θa.HJnAAn`gjdnw>E,)NU7^5e1G3}q`Svӄ2 $ϗii[h=GŤ ,,Avvx*RR)ՑQ=Ml<I6dC8HH_Hڵ!W!@8]!I i$k-I1Қ(cze۠Lcϙ*%bɳ?rݫ@4&,&&EiK q#d$MgU^ X^^ V Iޡ0߅WǑy'w%iVvkB%5󎌕H1sODTw PO brb`P9o:2DoU3C@b7P7F#c:;?LG/r>9j@'} Σ>T+KPs i%aS$vWO[<{6_)A˅a?ګ9#4'R$,tGG~QK[w=JIE}FxWFӹR*L:Il Q~櫿 /oǖC\O3Uܮͳ7>_8<ܸYtGފ\ob6).Oaw]4KIߡz9mIu;QJG*ǼG2q j!vT>/ IPuszT^x^U-[-lB]x@R&Zf^ģU΢I5u.ז+~Z?\"GhEuGGԖ*GKIgQZ=lZ?BO5#֘hR?8)G5VlIQ{Ӗ;kpqp/0QJ zf>͎?ɇv7\ypiV/F]2Hc?qi['}Q;rw卄qԥah񸊨][=}tT`okmrBt6ڵ]6kTdILP&;ru;<າ*(W6)d2ʊ#aާ噽<_c1oaKRTvZ pX㏞ܛ{NۀC9ud42P õGVL]gOE蛊Oۢ|YӌYvfn)["wTyhb[ߤ'8;Uæ'l)$dOyY1Cpc+xvΏ=mUhړi)LrcYv.δwPf4u~+CKL]64S~=fio2>=eҫd\\87I~?}T=L{(4pYROO}EgL0/ҎX®×b$DȫNġHY JeJD–IQ=@vo򦸝(pl`Ag^y_x \Yw)ECIy)꒓~=CԑQg+_޽?q>9Va "%Kp_`mg'cu" ?& Y)sFs(ޖM+a!1(%mG;Pҏ"=B( @ E gzl]mLv=8V<1x_v9s2KZ/)^Wѧ!ZGDb=!^!a۟9mk(cm\+i-TiQ)tZ;#|#ozaM4Ob9~)83dg'G)RN&hBìqo.䄺J㝏;:O[MdGdhZfGA)*V W6H:;?/~bu˖3K~0e!~BOLV}Ar5|v .%)RDuBԆ2+tX\A/2w[N >bPtk-4[%! 1m7 g 'a'N'|yRCy|9uPBMIRA'MԬn}/lG+^ T8P|xSgӔq|_ś16 YbیqoZjن@J1= gtUR)|1|a*VHt&#a3Cw+,ݖrn#]chřsm)ДztR̷-s"7&´piBf}~ʏh-M'۱6Rv(Kyj-I[^ 6_B|ʖ'm51zPyI>5R۶JIi?cE5űSHJDD;(.ᝰ40%nRT@65o7Y7 rkȤ}k9>*87Z0 t#j3'[mɅRH"{sLw@}ZѪpBBo|A\R;F@>,D(gJDìQxR]GL)U 哼e;qF5qc)pQK}.b7iGG0J0)u އS))E")DYۊfe:C4Xxn:J/c^l;}bO;ۨQ|^ŚwS?IWG`;8$ⵑdyTZR-pÞ>W=/V=u=2萼b8M~.=zZ#ǓCOdzƚ0J u09'ˎDq߶Bҭ'D {l6-tiDBf8_I| ǽMEJ/n ɫjpNcQ]?+yV}E66&RzSQtP+& -E]GeߑH*DΣʃax1(kl2YQT=,*w O7EEѹ<; 2 ̊`n[J%DU.~6(jiXbQ_ܡ%>W"xQK[{wlwV>f T( ,a@ڸؤ:F&b~uؠ_E&}j)Z5OX#t]_Qz]xxsv͝_r)> ?ܒ:[f;0%Z7 r7߿NJ JVRcz7[>!+[|"Ziio$U4Q@nYDgs[d LqczHP"PS o. 8PPxw;U[9Ftwqz_nK!%S<sV $; $5Z?oW\gmn"w'CK˜\RVdN4(~TU{.nc`XF_~êR%(\uYſGd UiB]ie`)_dJO#Zr|mTWb'+iˬ% `n[ZLqJ-oI K%v+ ;5IM*lJu{EQ*|Q"WJH^$F0qwPCN+A%'Fc輺w5n Z]hFpj3DG8+JJcEg1i iJ]nh=jo[ 1aVhqGy)& ҟͤHV|VJoD@gh(JP/QrijM'IJA#?t&kׁX{~f 6 Ż>)k}RϦ#(&ڽP\?gS7]4hHQӡ'I@mG<:g`0Nnꉵz݉rGg\pjRA15U"Do+ [N A z(t (+|"2Ӯ)贉=mV]/SiVFfJʘ]e8r M{450Kי~lnmL=o;P@@߂= lw5O1nm,(mk -/sK/N[lzQ' WJz(զG'Yک۴h*Zj X*'EbY u`:R"Hnj$iߐJW~yu) pQ<v:9k\k,eLӸNu0zbT{Q:}MI$3eVmЅSК.E)Yq6"I=;UsG o49 -$=WPv6۷oQbyH 9"{ V*!d`6vIO8wUʊqoP N?X+VV?BD7Xʼp8u fqpY^L ƴuw U'Rz;ڐU н@ =. 8m\Dx ɮhIbxy4#[bl'qbJ|5~gzn:nABZsT-lFGZghmA$=$8h4TzG{X[=B3/PFޛtqmo0 )3(Яr3&!H:p6x#^JGk)hg9j%&!l6ɂ Irh]J^WBAh!꘸ 9HGB3ӊfM/6M"[ɯa+y b]*}ľcCFdZ ]_DK Խ5˹~sR0Sov_23x&.C$ &7bįwlHU6))lFZy8o芉cy!6xRT<{]OKKf.,>k[ܾgW@<ۻlJYMdmMc_,H1w)b0Ф~.A r@EPIG ZǢڠ%Br haaknVABGە1o;eNrZEE6%pVS/JHB cI'rmz:|l֣-!ԍK L~%?ɲOeh,V'H$h~]{q):s-S:9&:l*uN]Ke J#R YoIj]Lfil/\h!r=@;P}$;kd]io)nøށY./14n^tzHOPwm5$aH-Y@PLL*LGx$$r40oV6N]RorAtTH?u\ħ{'؞3;Mkxεhtqxxsc@X5Wq֥M:FEkB[q%Dq?YÛMڧ_F,^ŋLHkz9⨊Ph%ABE[ݑpi=\qTzCVV҃syJ:\eA[X:TD Wc̲FF\oSixޥU=EDRHoaczB#a>e|S0Ȍ7-/\e*A ăSxG2Cs?$˘8[TBuIQ{QJS]JEŠQZzIclEwʓ1;sRᶛ ەqpRH35U-[])Q+82\J2 $u{P/t93#)x) JH=I2qn4bvq[]$.^DPՁZfv0}/1-׹JUwIȫ,9c֭9K5j\'eو`:x-;L90.%Hqᒭi:<@>\:A׮b3G 16o,^i$Z] .'\tO[O ut]aIjUXg*PJ`DɒƗ7s1ǓnZSDL$Bb="'~Tpdpl g*hҮB8*ӧU#X(8JaHKa)GttQU\q-n$O8=N6Ijo#)f4'e*mZ*U3yKiYX 1[cfbNH!|0üH!)=x:VFftj^B*߁ڬz0PZw&p|Zch2sQNNӁjȮ5ńaӜKÓDIDt:T P}4S)g'xf R\;oCD4 8O&f6WI;#n*ey Sl6ku'I)$w3sҗzVU7-n]zD761wkduNcyW+LiTb9dF5j(,}M|?$*Uge6@AZ=I*ՙ/W /sUh8v:NsW0ơdK$%0(LoC9Nᕗcܴ!%A _衖YG`nևXwƬznfn=(|?E/q+-tI*hGRk]Xckrۨ.6JV6y 2aMԗIm^:=ap}ibS@&_pyxO1Zw;)'Ble˙GV^-&$A3ƨֻlM>Z;zLj c0I0tU$PKHSjűgpkH+:w?kcpbKf>,ܥ3fm\RI :uwI@1ɃvL +>  ל!(QH|?][p"@n' Ei_rJԎkW|1ڸ^rSLQp)~: 'X7ؖ%k&RRVmJlJp@Ȧ㒜☱M-4" =*fOqaa[-SST`9Yy[":3*̖ < BǪ}6DҴ_4R9)d; uW#]&x? }S&%kL~e+sorДSV_"/{`ّ{EM'f#T )k"6M1H6qM -$J#gZ@ Z{Lj'gBEd?K2A{F!yxZPזBgjxO1\ASJ| ;"$3'ARaۇtFo@#$$O:CTN Na \LmPRGݴ2hLM%GnoR\ ,hŒL:n|m, # N}uULtWŖűYxI$i}w7EKvtKbDz͕›&8ڷ~͵|0uTaZVPD*mU$Ln6}3:j%θ3ۗWNyiBh&4)y(gU2K#nۍ&&DžwTw}pr'H jާQ#\ x~STʼH)'WbnCvܺWJNv"Q%xff}6%.;d CNW9O>̍X;\1TN,ȸM :4<*>6!tJdmpPZQAVCY)9MW8߹.<_d☈K+-E<[|h,\y^ *@n{i*K/:3s-d( 7ϖ@Yy~1#mo;MNu,8 Zj؜XTZ~;m-<;,Yձ*TA(PoRhPڡP4 q֠cA<V,V@xij>tۋl]ʸiMJJ%D#,Eտ&'nqwi.٥*DIմD#=G/GA 7;oFC|Ko^#uRִ娡d<vkܓWDl퇈f^-Rzsjx~iKor_q38%)ԒOQԼmSԟr)0î$8H^[R~(iZʢȭ4mWJlUďaov@-_ 's'ނ͙$SVpmI$tN2z&J"z.Jtq]B*TG#z\8^ܝd&$gXnĪmJ"FM6^&؋^il}~ԛw5=@ʏ~|P6-d]Y-y`ޯF-×1V1nbO1YNF Gņ\ZФiQ|eO\Dg+v7~[v#zվ0!YoAZTdGzX-P4c_]|)31V$z,fKOxr;@|\|(@,KAI#VZIqO9)*2X.*?s#NΕ=j-*DuPU I1hco05MӍlCJ6:-m\^9t fB%3!5Iru_> 8_ar-6mAIԞ:֓!S\|Y+E;K$Aj)mn/ЇUU F 榏B6.KpM4vZ~m=OZJͫ6%b)3L6vX=vdoPN}G QWRgxQ=ZD2B mQ}qnj&+4VËY/D+L $&l ֝JXv4>IiֱT~h"ƱvAP"4iD7HI I41 HJڦ[ ޕ =\wg"l$^|G.)ℙ4HuzSUh[S 0`™%2[w璻{ҙRUT%]"|2YuARGhT\r~>N]#xfv4:N@^ɥ>QSك,c9@I=mOw n?qva 5'B1'&$HjI%xE'a~"#q#aO-{Q$/մTo;qiLF39fm[[ "}{ &PȽ.Qưcp):N_\%#j.]VD* *p~ :%-nkuiH~;..Sr߻z$H߭m+DZˈ*ID&(9-n8 n|G:Y'*trJȞLȗxn!S9 󩺾E,buی6n)7Q1=əݍ8m"-iJ`)iAO"*HQTG|эa8h ^1ܹȆ"B?`!:ݽڔmNU|p>U{.v95TW8^IHvڎ MH#MbPKe HHɖ [$s5xm ;Sޅ[NT#ῶ@VCIicHEޒv41+*$xMDId jLNql1d (R9Qiu.ZTIp!Q9nT%FiܜuîCzs]4pwZX?B=ceZzW`-RQ;n\ă^@Z#`#FeTVbrjߨ,p-7.HQj6zօ~blnj7mklZFI>eBȯ7DemدrlIԕ  6Z)BƜ7 d^5l\xn4v˶q7}Ej 5d+<ȁdw&Wl6*ʷ&4k^m 描$QrAV1=vxZi/)WmwDlF)KI ߬վ߸ OXȼ %hr_~>v|/pAqgqpG=I:~'(_g!j~' U伝&UFC!@  7Y]6"x=m:TIlvڨe)dv2SP:ft}F? de$kCmN!ŶJIb8ڴ};%5byml@={+Yq %pLCƳOQ,.,2ٴhs7d Ih¯mt\V>{Vdɔ~t<ҳ$~8s:)Ad=Rj3%p{t螱Py~_vJo:+$o񥸟0X#05}J@:#qOXT8̂Q+i[8I#EXtT]lRט-שѨ+xG{UUO֟,()WFƩjv_?q; ,CV$PNTCoP咗?-J/QFX{XxK>Sz*CjOj;almN6RRxT7&E =K -%|h"eld&d@=gGp&ON̡ql0᷍N+Uf\w>K_eo %8!Q«2xE'{A[nq١ڒQ#ZtxS{5=l Ru>r*!g..w%^?qy_ {7@mgИGOڃӥE,[eD0)Cϋna'`y:BGO鞣oɡvߋ9bOeRY؛{;)a`q`v>= dy]W_Ԟf3 %5JJu:T81'6NbLFHnj|#\X̍!/#ɺQIH*p':Uub|χNjEIB`FnHKU߽v yŖ/ Սb@)Rt1*G),]SnpGXy fx&:m(gֶ! ^:o.;!)-FD?: /SԹ\{ -t n:V?#ˍcQi6vgF77]^ hg`{R;%pMz ͙1A|ぢGY7c WOZX-N_@RG=Ts ·e/ZZQ[j;:qҪAIC{޳6΀X!_5f 9v+3Yt%}Cl0Uu}5+|\R-#ԑ*O::r [բZ^j/uk!sU҇ظB 2Q^?xajK^ 1;Z΅d[(yMswoZ<B{-AB xqZڟ(d{I~"9 %7̓BRFCPq_ǩ4fWOዳo!-IIw//(5tDggI#^tȘTXQN".P~OZdZuE"B50$nq*AsdvLc5%aڔk*((^{h.baQ7sPIA)2Dco -|UЫu);RS1 69 (ܪpx67q ;6uM /c ̄$'@RdG~* X4JXھED9o5&HJS3~)*2M3r6KJ$'5.!(?KKV/J*Iv9[Y0}SQNzb~޳29=CYx?yhn>cΫRR#ضA2;?|&Kj_*DVgmvR 3pa-km ; zՐM[!fbm<]>M[E|NW +Y jV$!2k| (ĬٺʐT*ۣφ[I/}n:fzUcx,r*(oYfőpO 򇚲;FA;AC|;`JrT¸zv>3K/.7vOK4gdJ~D)2:#ڋ(鄯o~fxq쉇bqBЛPt4b$NGNs[ +GbpxڷBoWiJ? Ol&FccV= ҭ9\D5LH"~p wsNKh(ĨǫjN:*ږL2Gq5"96Y]*fw )=;+kH@"V6džs0Bӥ#Hj>YkSC*(˱l\S =)# w uXwYQNa躶vV؝ꥇ]#[~!6<нbI\F&t3ڪ[p\bk܈=>K I2$oZJJ髕VOG"\"}2?5k 'mR;C]-ڹ3J4رd[%&iCEs#qMhIJIqGcv~ͫ5*F Xl\@PI`\&ݒFi;6FM%D-~6#RvfO#id2V]-1 ̘ 5eLS30TF=qW]O m.Y8nqPLr;~3${֘]f%HH<;-erެUep_A㎱G2ڢÉO$錹w̷J ug)RfF_z7$<6\>RmozTVź}S'1:gĐ=)p$wTFKWfm(ׇbGKJHHH=L0Sn{ {%hA؂:T0սrCCR|~oOmJ o-(ṩ6aW?(.L} ^/Z`8Žt0$zJ7#j)廭~J 9U&ɯ2%Q TtўUcx_!2探˸[/r?Zx?KK>٧t>YegZJBD/mY|[=?P9w+qVY%gL@j—QCmqM{d^#X[Β1v,3QV MXQbT$ :Y2jpWKjb s Er~* }|kt/Ց*V8dI%!6-JcʄjruL$#M?coZwP 9r⤣y-Yœɷr4 '|)ex2ZRBPQ)dY@'ڇGb.n64u%P > QU?=FזWvƱmHHLe’_aSXBJ:6H >OJ.sR4*EŐ{ğ®FiKJJHx4ޣV?+EI)W~yl8FѰ)qPP;80,TȮ>8R$TO[)-,pEŻwJ;< LK)k5P⍄l_^RxhhPX\ZHAGg~\ @)k[X4\JևF؂$֙, nU ~#b4]b!C@"$|j-.w?T4nhR!'ޭcm&ɋ o>MP<zcv1a/JI L6yVb*"0& ZU(3ӨS)lχ]ުW X!:&b  eᆴպ]D%Z)s]lR,}TV)X %I;o6eu?vu{0 |E͹y2,ԟ[ kR47[h_JZIioE|"ϣߤ\#b #Hxj)eOƦ驯c2ƁqjR8QXTTܮ/bsl҃`#NQm5he,o> Lf>dn&37V8-x!!D j6Uwj—=Ѐr TRDbc$6<,@:$|ߘ'·Xٻud6U! &}泑ȩ㣹~aI]4>pAI&Vb@ZV}S:h*L}WN-^9N | 5R#n "jtsbo`ɿ$jRgh3,:':-5q\1 PIYzi;x=ybԡе);@'ӣզ"@M*op4OI,I jE/A_P/ec3+nI09U>%ˇ͑e8&pSbfz>՗^]['ݢ4%$$BzGM@U#X>7m1ۣ EEij N~(8R[kƘ7K.vwIϒolBO)<XC$2$j->6zv`gܝ8K:Y[^:E\Y˒abɵX ޳Yj[lFqQ }}BDauSA?do?TJ+(:K+h H0 k[ 3[oYRRuZzGD3.` e*Ht|+SGEJDFZ8Iz64%oq²=_QQ|vg4\91N\bI+򄥏(ۃ֦sp$R~&wU,ٶ@Z06VX1,qcd/!kd,'_쯍 dK"/\wܩP-*SH"OSUsV2H Rh$ǦkvX J!n }bP'SXqβVdU]Y* 4ST>7-D0VR܏Loj*c{2xspt0=ɿKf|K 0WnվAYJHOT2N7Oi~ Rұ-[eO($w? XHbӢ&o~)i46'[]){:͓&ihLj~q*JV J-FfM5]BGpVS41ZbA(* RV(l1,ԩbH4j67*NU2m$Mq9$^.U 3PJ8ŭڸ =hD\~UF]ѧIs7w5䬒~*=,m6R$j1 >Ag-kP٤ԽйQc͡d4}sVoр\ܓp'qm/:e0|E-IR PJz#cCfV-86 TTTv=~xǹya]^BSǨӔzU8 !619R^d klFܬ8T?i)i-%ꖤk6Ƶ޻8Y% YmݤuMt8E3Vr$u.Rz[G;'b>xTqk\"Օh;dHPO릾]yM NPgH}&1܇[D5 :B6C{pLsBk˩~տXLt*㞛å(\/}ʐls: B[Sam'ǵyWSYB)-? k [IX'oǰrJt0)5Çތ7U}"U:U=M5.W<9jfb6Ę#ډb,Ċ:K |nWF~̝Pd l$wk7#ò>ɦ[˜W<{<;zbvn3uܴP)uznC}LϗBiP ;qc֝ ᵻJH@H#Vu7.KwC#O;A(eq[Pjƫoہ}jS,!RRxg'_x}ipC @l`ĘkK/zKCχv]mvfjIRV|ř)pzQX)~!d)@{?ULOfWP!4B{mR<"HU0uxG4v%~x+РJ6ȫKTIwRŻM]{BH)Ic+z"(L2ݳ$ I~TjZIįnlA $l1ԞR_$] q0G6y&<<c̝.F"> OY+aA,fݕ. DZWL=+yJ=;v"_GS{tUijC1=e!gω8"b坳h-*@6 ~.*~WKC\&o26AݏQ'c*ENirxzA?;q0[i)B(کtN|S!6n҂DD ޛ m^U9uM-b 7<%G?I6od>З)" 4~x"Һ澣ʚVnt.T:$ޮr`S"GoiTJB2G&'i7Q5cmxí2%e#d?ܞ/OrL.Ɣdi~y`;$[7lug7Vp'-/-|?jdӡhd[(J>Q')ғ^ 6龹M’4|O3zRqc>gy{U'oqц-I'I $F[d$:LJ+hvVmpT' A91neh핺Kw(%JJ7;v4䯱 IxkChС A3v=*Xc.\ܧB cˈ$ĝ۞4 ^-75trU)LitZU>1+օׄ^Z.`dsVh'6v;h -${j=緽d3RbeBqN25%4nqN.RMEq3xN:yq $V3Kvyjߩ&,g/OuQ^)ҵLz:"ʨğyVHiؠ+ Gw܇xpkj/uԝiԕDvƝ rvT$kmISPCވIXoHmnOedhhqD.T >!iD>-,.=dBIeo| =rڴL؎Y~ $FʫS{,K Ob׳-iI jU:ȩi؉3# [a`JTa"7RwۤqcwYkW k0r8 5).!3!)I~Ƴ%,jIlWvЧ*N1Ӥ#q_A>EɚI̚f|ײE!J\²a'a|nTmJ F6h5@Cl+87{n~cjĬruX,y@i5P0ntTSvg_S,zG̼o<6a!l{ ÊK>e>#bjX;c0:B&e3\V=6 3v&4۬I"ROQWԬݵ:%qL%VdNmi $:o"j/C:8>2OF0gɲwu?(L-Q @*\Y2(Aeu_N񥗈(&<>nϹ/.mqv/܂`;ژ5ZI 4$dOǡU?W"Q{p:bw@J߃ 2ZXaЃ= @zI}k3ޔ-Z&wSny%1\0ǰk(I#~(ӡp-n)υVNI,pm. uJ M va7w#>>IVܛǩa{2~@y´U;/!e\7Eo77k&zU<**,篒kkP84A%EHئRHFN0MMȤ,ȱpcpheH}PiG n@O#ؖGw,ۺ)~5\ 2$" ceR.8ư| @u߉Vܑ8lBK, ' EPGL?YgSE$ %qP\u+ 1l [-U'I/#IǝA#$s9'{g+\}h %$Nctv5U Jl[<⶯!e$I 0abܛm|,/O.`JfnLīq1mw ILjE_a.}T(%K >aka^[:aM5$T5t![csG5eZsjo=Mlg=2cFh sݍ xs@NM>FB]mN[1WyUB5vյ)DNЮ7GX]H~9)eQrSdOwR5nj%ف~. l~i[HPZB7Z nj,zI?C1Y3u{V<&;VlڜdOc#nAPHD`N%uy(V\:}Q1T9Uʗb)A˂k}E8) H DZaD0 ݆a>16t=SbxLnhTU"YkaznuPDPdFTt-l˵P0JAۨKoAS<w>^1*O1R2p1 x ~\%c @44zX#ɃRV(Ħf5Zm>́mt+-mB@y)P<Ulskn/n<߾_!-󱑷N/QPܟZᠡTGSU0TK ܩ_ņ 6Ե; cqχ2Ҽ<$t35o8|!r&6{eM8@Qhw0cY]%8$jFZ6$[\/mMڧSװǾ YpQ&NMr.Ĺuoy@@ztJ90jT6aX)4S#pO@q=i_V6J=/&$m.LtS>!ci 瘵X[&'$U0I.W~.Ko9Ҝ%G-#Q t/aQPNJWZwfǧu(x6czV6CLNʎQ=GJ:Ļ|0'z`XufI^G4o(gTh㭝­TA4k{ݴ6JyB w]Q?c?^Bg[pX2 0w)==E?)n&)}@yg6MXӏ_mTLTf6JZy"gd0*[xHAT+ )j߁[*fsoGJLu)1 H|o±F-s^* +278mv*qae2tC=$%Ytn;ա8AWtK$UTuxTwS)X nHcE C 1 sB PRp㯸QR֢$'OJ= P6jHt# L[_ Ĥ24τlJ45n~L)fU%?tڵ DZNΊ|>⦘j-[Sw2nH<|(I%}* >65x<|=7fe_-V[3EYBAR Jz Ȟ (~_GOd-!R?xo|reV2Laj#r<eYo~=D9aXfZzB6 P$wO,{rҡ-:4b <tm %R Isad"OuZB'4-G3N#eoY[ a$R[mJ;% p%St{ jX ¦g,[ O=[GAI$SXd"qLYAvޚ(z*8#jAL VHW!Ǡ7H!ȣQ8H)R$Lum2)3`cUixaAj?Ɲ JGoԒN#Bv]V7Oq&8:!\tzdX NQB6'Ng$s6*'ޣH#Hr*|XtmvIuYLגX^Jaɞ5ܚH:}q-iku$|yerv~enqLoޟOԊ[Bp%d8Rbk}V@YCJU觪T}a샇4wu€A $WPtHtTtH@`;:SuSԩȘRO`ciX\N'fD\Є($N:sNM!v+cIWZdíU|)%>}(l(wץW]BV`276,%äMXRu3Fc踬7bWj&$ڱS%>PRf:ūSs-I)D.?XkԱp+컕}`$;~V9:}dqJVl\K?\w?֫B-I$[|-֗ڕv':ݻ%Mf<' h)Hr@8PK#{w%MDq\bu Hߎ[ㆼzZSefvġzAx>5J ǙP}]pw2A#pYɯ]\/b!kl&TMw2RЎ^qK^*[Z_#8~GIv`ojTLxn,CsOoZ)|O N{ߵAUm^b`{ wOթJOfڼRMzM*#jS@ޛuN-\ j@Tsdʯ6pUvۡi3;ӧB\S57na'Sjx}w U}){,YQ5j=O?lT e'z~B_<$-c8][9:0'@/r˘ٷԴڷ x[E nHX6}+H:uP۵@dǩSD݋f:޴:uG]j2Qv1Hm@ cPHTuIU'iKbPAmmA{ 'dwloBX pϵRJ;6B֑"f{w svaqmڣW*IZ!V0-`m&Nv\ՑCT޻7SBB>IF* }BӰ_(l쐐Q91ֵ>5Uv!漻e5σ )IJWmmڈ\-I%E[ahƕp>?*mАHQFꇫBMl2Rm}!(l 6;r> *+z}\PBB ޅˋʪBhIu5 䬁U@|ȷ7,\D]6.4L}t'F2;iniMuAM&:c֢M*vxɴ4PSzH>Ѫ#^ )Y2~<ߵ*O[| 7e;IB[(!j Wh(lZ72FՒK)%.`'RO+Ixp[%F͚v UT&4#c36>VDLڟ<:E26 >*>¤+ob\XQ=06ԔP 3)ሺrȸe6IFmڬ#+dZ:8:T-@{Op{W氨i,&N߈8ay?Wq!gm&f;M0.ԥz=#Bryxl\oϔyҸ)BsEK܍?2)b䕈 2{cQQG}'G~>{SP%w%wiS#օ˖ITP$G5xIpq$(}r*\96(Iki%MC#j&$`vXگˆ@Ko&J77PMc%;vc% ؄TQ)KVb^¼FHy"(gk BRAOsQ{̤X!RcPO0E7=X[d͗ZRP>rj/O,~[Cp% '#2~f5\g%g@v6I"IaRhl@R傘Y"SIrW/B݊Za519Qo{m߱``{ KX 1? 7gSB$,e"eDkHT:?Wͩ5{no]F4aNí:kvTL#yĮB4#aI +~H]5'>tTìb9nޔ mڃmn/"|ӕW%HҒ =:2f~!c( Y /vBTNuP[ĭ.Zn}o-6JVPo{lCķ'7U36-v׳&tu!ZIbf6hzZ\Z9h,BRA\ݜtt47 Aı>Rm)2 $s"h nv&ҟ,* $*$621ojW[cEͦ}v~†8p-+d*ɂۅ0$A#m1YbMz.[[,nJs [C`?Q0Ƞ{X+z*mԦ)7OMIr[\(|\[oK¥ןGEP q?!2:Ro>!Cύ{#"z’꒕ &D-ͧۛi<]Eʆݑձ+QnE[綔<#縷Yk. ,AiVoͦOj!rK{[Ǯ-ADiJ;Yw/#@ 0ЃZfM7FoM]#%i߭i\;"T09#ԫ -2bMխqBȕ4I?Տ`Zj$سI C04EC~ՕuۘkuD ­ڽ,~q^m.B>]F઎`ovKG@ެ|>L~cKӔp {Fq)΅Z?}T|; [׉pN!(Db+KX|j>H0Dx8#¬I4;w Lq+Jdj۠T!ՊieChGsڵ8:m _3g]0-uEqNJ-(I*xӺXD(J,('BiQ QH?Rlܞiz٦zFr % h;XL=hleՌ*Ŗ ozu^d߸-'67w UcD}xg5[sxm[)D(XyFs=W6SCzR+I$ UGNz \ u 9ZDoC!.SgYgmN?X\qq,NAHܸzpp89h7Q}!9I2?XI,IAMIC< &iDŽٺJTU}o.<>6F1q\!/JX:+0ep>n0]6l(% :[-5+hv"CTOVZ#qZHQku"r$])Qx;GdKJbd/U0qE/\%K|}+?)/e? f\^t- ^«McP;zDSsN"xn\JDH<+CN~+XKjQHjoz+hd%Ѹm,-1{U~tmIaV&iPH*ۥ3v͜FZD+h{l*vۗm#WQcGo ]vORar,dӭ*OQ۪Γcw 7Wr=AQy9e~R/]ʴPy:NSd+it ]{W[7jWB07s-7 d C4mjN\~Dٜj-)iKpUtjB/6=nZrңvG Oeh$IfNm.ɏT.-5H^ _S͝?p-ܧn]±jY t~&=rNFw MmNO~M/Wo-̝=۩RZOy>5i9F*C%j̻qVHkDZ,pNq*3MvXZJHRCZeRveuk;Ҡϓ̪K]L~Z[+2uq T3|n/_#FMI>u rKӈBgEMfdiOE PpqPeg.?emQx#h$o;y:mi.'WCR/Y>QcR7Rw>yoldH G;'WnnJ%N?Gݲɧps/ܻn $8C ͷ6-KZ0<ե"v;z{=GY_pȵ'G|іnF-d͍ y:OPܐ.v2ғ- m;@t'Đ(ʯZ-Ix %D(獄ZQb Za೴A)JoHIYϸ[8\UM$ޟȕ,Z̲k*agBFD7;&wJ/?BgafKE3M(NÅݺuqM}DKwVߛ!)BcH#ߥUȭl((g*B\TLZGY?ƒ"]+CeU9;qGZRIPIFb݅kr!]om6JYm*ZA%]ۥ?5c&%9B ibAP7+J[e/@PKn/L1җR8nROh[Rmи;94lu6pMhmr!bz6uF.Yaڗc!8nMzuwط-k)(E# Y'4!MK1T*=M6i=Һ~t %HpT׿4-Q(BҌIy>q/b_qkI(:+>\̋'Yf[nW(=껬WRbC*wx\Ik PKGjj=MO RN(B:SɈ3. t틞R,m#m9DF$},zΨ:AiGdS-uO1 #fG2 f TIi+U|.!RROZNC:C, CRiynףQ؀(.bH-[or1]$(B%HXҠ, ȔSܸ'։y]1zrRB7’W=A>џ/޶I\Boi^-R|fE%dK67O=P t1]䎞^-Y,e0Z({ou[* )xmJ]l$$*zKn~HcGזw/ٲҰq(JPqeg !#NBպIq_Й5T $6BDӐ<[P"CL 8L'+9펴`㐅)%[GtFYɞ;T#g-HTErG}u!̪ =LP,VפSJ:u*// ֛;+R~B:ˏuaspu[8 $$誼S\w-2c2XLCwHj'Yze?Rxѻ wCdr֢ ?I'&ZOqgJ~0bh6ZԨzV/jԣTV$-Qܸ6@sK.<q$XQF m:HOS~ Q_fl"pl-rۃޫ!7~gUkVb\uU=ڴ ؤǿ>ǵ#l'= N.' qwo[+G,].7ސR>߁ %F%={nbYDv3Wd#A kjmKoM:O.-_=ZK ~e|J#N;ހÛz%b&{/_Քj (`R:9E-VL% rb~U:3a|naI"?a{:iR+{,_7P$h󂫿Ri+2rnQyop-3vUy<^NvINڥA ۨ5Qt*Ɵ8v<Ӽ-\ߞTqZ ̷aZ!iej*YrCM \p5|<%/)]\[/-,Pi>I#tYa7@΢Q81>ɷ% : '4A$pl-ޥ!KJ`:G[4X"݌exI@ l:GZ\,!gumHXP&B>|gE'gns q֔5O"jR؉c6La(+d(ʟ-Z]D3:oƒ:ᮭ1yv1uˉ{V&LyT92BA!ǔBȝC_ }O^%Al2Goz5Lbr[v==ǦNڈH4Ņaw7#PWRciB~/`9P'xI"ꏦ2c@jqdJS?E#8IF+i>pQQ+h^ ujKkV?Vm=DZu'~N l.cJXjA?dv:>.찌GAԐ&83#ڇE8. %@ `I=wOwK,;Q )$N{ &kZj@*T`@O w>Х[Q| !F R ۵wXz]/wj\m=3g%]bT#in0PI1 iȥȮ݋-W)LʻfƼ[{u%eoL6]y[A?ޅ؂KvsJeRX4Tz_O Է5l:iK%&9~)uiiW3$ O,# \ ۟E6^_-s r?eRDr*awPq4d7jx[[\P3۬=%7qg.OO5rb $m;oԮ*ew}_ID#{ug㣰GkF^on쥕[I~Tr:EG,ER/%Y1W- ؞zAⓢչ$)-dPPL;h::+lC̸JL%PVΙj9Y=d`fZwKEH'Nt*餚ӖϹ3b F TK Bd)G3څZ$_ Wgo&N(vӅj^)?d<GM.;yz^,'e˺zb:xڟ=w *+|#ÜfN6u=Tڀp6^%Oу&֙_UmamHP$px1"k|XsWjRam=(L_ ݈Cv/6 ]X %=Eu~eﵪBbub[!I I=`VHV۞O &^4xtTuo֓ :Qb)e?kN8ppTa{=zfvi}غVX}/-lI$qScŵ-RZj{A)sO;C$ެhv'q˖0;I!G3քRHqyLW JW3 ߥ^eRľKA"oquXx,[ڥb:w C"ްm66*|r݉waJ޵w'W'Q&<}2D.}K^"Dڴ/IXӠ}M&+'7cj/EE1šYXUD-ED%s:$whe'Jj"19tj智axPj7tA04=v'JIS,q_7>e`|됔.Ss aoanFs[y6n6WN5:+yж7RS*ǟ׺sviQRa Zx#sVU7wꎛҀ'|븝Auiq~:1/rnroeHr'9G!Anj_yyA,8X uwJdq%gWsd ߃x4xZ۝?כ; bFޙz^8C/xh [<5%ID‘1OZHSz.-~/5Ý1[bFʾ[{*P족sBoM4.V#+XԤ;\,&LM4 N71ԓŸƬׇcSW!E:E6ve±[PG~{De7 rL~prJ#*fvq,yWPҔ&lq>7GWqمJJ: x̺SjHgK[7yN1)ǥRb not*rEUtdIpVMIc6Q qm \k' ?0F.qb{T-{.E[{!8'3*ZдH2&"z1Qv axur\JB| >OaTJgRQV [uX]-Oߚ3rQw!-c}XZP)pb>a(ǧF` ųoX->ra.\qP Ԛj];b2eau2lsaX jmcҶ"KH0jX cCrmRRR?` =/(GQz&;20)̸3E JzU9^r4y}Y d?bfqoaf@Q&y3q'ԥ1O;F+8)%BUA R*/m9+R0GQUlZd#ںUŷBWȝ1CPP.aVi#R`ԕ q#kݳZ[?dnLMP%hu~yɬfj@zЎ 5=#?xL 0!B+~{kz̢ܥre64bW6?Pq- 1y  <GԽQR$ Y5&M >W`IF 6z! HذӾ|O&I;gRj686uL%SqR!=\%$ʦCB+X˅M<8N:? u$Rq;`C/*ɒ:,eKBȁw¯V ePGlv*sSr[8vZV8H)몹OW3Ŝ}0 uo; C2gje/ |ɤ?S3L(QVv#E,7.II*>>~KL-E=PG^=(&exjn~t&ٿ-+uEBB7[גd%)466bVBj4dcq+IQ֥umz&o ~a1JN6eM ǃ N"Rqcin@P>!%-K %G~Ƈk%'?/P?I ەx/CGt%>[2U*o$‡71t0/\TJyP:Oo12׹GZ k_m#~$KbWlx;vѯͭ[>*,YuTeg48=HrijHpwtâ^ ҷvg+blp̫ %c~#9KX(nh5#'l@}'Vm|@fL1Y$G"l;˵(14䪱amՓ\RU91n=' cwiXi$&ޝm^1lHM"$@'cXt=!u+* 6jm69hfKvhԿ3T٢RDlsܭM8 ÇRv%+kiDzoq,NB4B|6uK`A,o "jʸ4 uޠrG!xms ReIIM{.1a@ &":ZMֹmNgC3W{]ٻvq@'c'6,Oe'$5a `6!J#I +[8-}Nhj1Z6kf5A︣1`C-D>ݪӡ[s||zxDawN7Nڄ`?t~' Ibsc l,$ױ>UWˑ6XG, "㚳͛S% [C{9aZYtYz7+Ⱥ bG$@5n;_p,:$(p? gK2Aȡ@gh@C;Vɾ lwQޫd]Y}A<gb˭Q ܚ♪ [\inNgXvޕBMΗMXluب zUk.JfL/'۴-dl3rv`O"9!F5n)ughmT)&ʎ,ɚ/m6V'OVS⛪9aOZ6oB_PSW"<:]&TX+85[ FJP~3YgnlP|}辑I~D$KBNG/dmA'Kӗm粝MΝI5?NOf$y+_<3 Zcsѽo[nmp_Y!weOGoz}kʭ S^iRu.(hp:[,N=9^xVQnݺAO}!Ẇ.VCB[8H;m>46Ę2xTɑDʊRYKS۱"c 1P IΘT1I2 JVi"J[qދ8:V=!GӼnNS"9+JLwx#HI#$s M e:HR >^sW IH"#h}Qdj!m7l1~ZQԐuzp+d"A3=rtNBuۛ(b>>t~1.9mfT[jIy4[b%D}nXSNcb{m@%ő6_y}҆ ^@jH 7z$D6+2 T8[u%JdcH◳U̟ujJJe;<5 V9Kq/&8߸5Z%[ 0R8BgPRt)mErT N۴yq#tS&=&6`mr\[Z-R OX$йfi8Z,0Gܹ_sh0PzveOqq$ŋ[p®:aOR}g hT?sd|A1mcUyfKrTpV"`dqc6kX>⸥"656:A<kޒ ";,Ғd?tju;vHYU>[XJJtYH'}1m,j!j-k2mp=Ddp}$\C:8bQ* 0:1awvOEq)uUu3i~e6ԱQ.93?2w$dƮwD A|#ZW,\>TR $=ֹX%HJPz%ƒ 0F0sZ ]ӊǹ-L Ϋ%J;NZցOsanR;X-Oz-ՏvsvKhD}A'`7 qz۸>再ZFyhVHF>83ce[JǤ|=(,MݎD5g-%Hr@)ACA iq(!h5rM' B[0n.}֖O$cLI9± *\Ƒœ0 +I$XCf ۗzbQf# [>L{1ǐODStsV/o2m鲉ȒZzOK'S-k}BQJҤ)ZDt:eɎNɘm LYO؊Zq-+'l6؂Q!,W`(9b &Hrup%r5۹yOQ]b+X- DӫHӎ>4eLop|Jyuz-Q IYJLՕ+{$V>"Gmv/%,!I`":n{W`Vig:fK45"'_-k 4F#Lї2(.l)kkebje Z~#rTwضgeԐUWvSKaVoBZV(obGUF\= ddQJSymɭ1۰ElF1Fƀ ӻk'H =y6," <}ƲMqkgQoBDAҵF ㍧nކ4yO[<6+SkBR&RH؊Zۘ%=H!wwñ4]KO BΓ?h~AV8#V>y#h/Vp-I>*[ 8OFVrZ",XHͺHP?*lb <4>lUTӓ ?JLj>)8y^bYDqnHݕDŽV<਀>ʚ\E>F/ltMtUZ%9=ʕ&ܥ\5 hx1 +ж*@AW?J1W9Ik %RnyGˆ#jT'¼s.zm=JJ"D60z}hq1*gG*Ֆ9jV#$53cR NE8rGDCMKz_!RiFTDsVql%AZT؎)lRF!mk}jꎄ%)"<+Mi.] Ɠ VM-ɗ $u(,i^:ͽt%A$u5]W9Ɓ]׌&wZyB._1b8: 'cSiq#~>JuC܄ߔQ3XKAa[]6zjYޯ=ɱB˅8R 4"RzoSn pBVQ^X 'd(LlrC!A OU%I  JGdL|l[?#HujCC_e:$M|?CY%`gY^^ ƲB`i2A j㍤IN>8m)N2y%ǒ^IRJI ;uMY=XYs!BPx}Ζ+M~ӎKFA@BJv>9- WJlHD ^\4Z b g5D Kt6'b g34VH(H Pk; ޖĢ IFR8UJ\1W0 8I ĞAc w+L w,bBn{O1V*Q@OKX2 %I9 |jR{˙Xu |;m :N;jJ$CF!ЕA(<0ΚzͯSz@Bcc mDF7Nę)Q℘ڜ[I"Nqswv#B;¯`Զ"8ڬҝz(APt% erB֥[qwPJ`8#mnW@EG} jv?}u`4ܽ@"i:)w ȾvJqǚh cý[uN" WrYPnU *uobT;oa[#":P9 R1%[}v[&zj/26X#R|./͹P *Un˚ma]j04v&bi1=BdT6x%"Gʈ^: BzMOO"S9X`6\:VO/Q<凁c {m!.$DI~ۭ%XF+Ƭ e.KJʕԞT]/~Ɯ˟U+m5L!3%[ w"a]B Cm$a}_L.³)ou"gx}F&Msf'ce)\jOX2Z|&3fZjzGQ֬6d4ؚ0/N*CkecӏjJu$L=eke%3.͝ނc'cHK̓D l$jZ~p9R+jg%ٲPkD@r;qRjn@d9_X+YɍdM*E=`ObZ0NĦx*eD6%nAqQP;.jy}ŌK0E丅=)Lj=Ut$iv,|/[ڌQ):tH;L',uՕ$-Ni'p~Ρ:P 1K uort K*+Rz JqPJ0ӑjAcͮ!DJ=7#DU(+z.M-/QuDk!F*==?\al}gcNCj!Q"yH'bx8/2-m)HoX-ҴYGPŪ0&,kvTT ڻ7Oj"ޗdj7$aQZ$tw~.EpܱJ$ Qa<끆`6yMD#ҭ'w9u Irʳ2cbVטb)WPӹ]4FpYش3vzvȳOzn>oA~n->{kO$ڥQk؊0| j@%3=E[CVrt6e{tEJ[NPXxVun(pGZ;Os/O?TZu?-K޸'z<yime"4Eܙc. )*ukV&a#KRplCnJ6l践f%HmŴQG쫌]C: 9*ڭFZIqאN>̝O[[t"aPw鯡 #.y`_[9mbGA\mU+,պ%"T@DzLMNY/ ?aH&O'QYol\db-: [t%$ DjWk1ȝP˶WWN=h![6ccwՌqjS^͹"!iP;X*kKT+ONoeIzͥ.1i5]rMZ|'+{bҭ% |anJƄnYࣾOܛ<20dMmevCmfk O s ̘z.l-ͅ_ST~=Y!M-MDP2D ]qjoke."iZ\$2OOWY7Q+2z!$p@j d5 RIW= odWnߡ` UBT@[R ?W̬[ϨIHvsS)ШKpGڦqd!^j4iF$FxbyK-!NNJS!FgZ\_u2GìM{n< $Hzֿ.?1WnN{*w yy%[4gTl*}0]alYuGbAo؁;{Ch™(g؎(+t,xu K4FJ.l 0D9 4QfOɈ՜^HT\:6W t4Wّ@iciӑ#bL 4sX؍%#wPO Pxeӓq:ѡ#ߊiTyHeSAX;N4t Rx!.t"hBg˟PqL?2Z%A(N#L[&*?^F*~(ܷ)GqUݳr ެ\lyM&(H8.#ӫ"y*GK!Tdq𨬕R-4 H>OlDĀǰe|BqwҠ9do܃&.bacbX..d)E'<+ނy5(̩-esUt ͬ;ОdύIZPiOQip'gSImdM?VK{. L$X(jUTKrX"#^-)4RP$:|qkI91NZ\IBJT7|(| EWL3r6ܑOqߵld]l v;yx|1ˠcWW7^X}zHWXޔ5Uv5,>{l6֠)_0:LnJT֏,I*?woz-/9Bt6ڼpÑtZDLmPf~\1i%+E[% p+h] &ĺJs|*òM7*]DJ^l\aV#Rr+U.7+lh\BPbJN: Nq&U hkgDw4.Hn-ZOn6(&Zc:Z0DS;oUK2= Nk\ߨ4^πmDs 8ԔL(t+rw ?4QS;'eLmd{R9^CcZ%M<5jJbũzOI0`ݗjz&Bvҙq{N k|vri񪵖P{K X^ l@yQy3vOWb+mid ScIR-dn<ޯ)LIg#ni4-$lbTNR|+G3x,Ue-’v?!듯B,+e8F8pf&9y[ȣekM+1ǥo:J[*i+ġ뫤>R~Sqt$|}E ߭Cnѫ%D6]`obgwIpjZ`~p+D]>gt|V ASU ^i1ӞcWfězFZǬߜ<߷Vg;*.w_lv=)xڣa45$Τ;v=ˮNS( e@ISEJ $5ݪp!J{}P~I i۱ r6Pd̠r$qSc8n'i#?IJ:#aO+jҴҒ tۯ€Ʌ䖧t}Wkqy wadUBnX`ٴTT&6;GOJ)yY\ IEdJPPɪ_*zV gmFD DnGQJ> ~n0*L:m*3սJAyTUo! 2U+w}UL:}_C8'1kLi>zTʛJ\ks LBiN9 j.Ҵ(t>iAO.?5(d( ޖH(1abq L/lKm*bsҵ0@ nY-`fLp|.V Rz6Y39Kt6o(Ɨv ]ar XZQuSIy`'f >4{֧V w,,/N; ͵K%^mĭnܶYR-*$z3҂&x\>n#t OxZֈp`Џx9SqI*%'ҩc^ļAW%axq/?~! IQ$z9e<*M^RRVqOM?XS̀pPu"AԻJKmB. :U,ҽ:ȗl0/JGn OJ5[pM>/]uvBGu՛ J0mw#|DEa z%%yIG ƏlD("2?͵wpmbAOZv䚠#9ܼ.%dSJH} tO*qN71 Ch*/a>zYtҒI>Q ËY&BFNORTŐO {Eؒ,1>BB`ƠSLt5MZ G2Ft^`JҴB9+tIg&/r~Yu ߬ Yud]4Q!ģ[Du C*7Iu;q%!yMH犴lD_o<".AS2!:ML%@9YҮ>||6ǰ<{ SE k@Bw\ [iڿhLDj"#jVv.(iHJWk3>\{iđJb*n6N{ V'%ݢ}UuX1jZ4JcŒ̃;El80vy{RI`)T58⎠>c$G[PREvbV%EzTA;.m !"L7x^]ۺ= oH}0yyg/@O/Ϳ6$p;Ojz xޮSrEkt^F$v2$#,{K. \սkbYֿK:I'W.69gp)ilՙJkLO$ SZ͒ęat(=[1`bHy$=n+;:!e [kIjO$Y~4ApDEʝWCz&NMW-%;f(2Rgwܐ-ɔn\h(ƭ4=E"icI5j3eە\h mj y{ꭗ2)3p`m֍~ce*k8,۴H.CM43PڨL W:~u ;8:w*wpܐX5`ENwFܒt,W\[f*ۡ$Pؖ."aĬ.iu:NɓsY%!C2onՠG6Ucs_Q0ڥܯRw(it,,s~v.^ W}Caq6B\p@{Qy| )s/]Y_HQ$S&,Zh*~[I_~Y^̋ R@7y+GE5##~OsOR//N:_#}^z޲A q5>d$%əu / Cs"74S玙PӈcVTMU;GM-A1r73ݱyhХiC zb,Kh)g~lXeٖQZO,ߞ7t<{isp pIiYBzTbX3or}`GX463)jA$Lם|xiشxŰ&4j+D{Sc[k<4!lЅ jctJaФ,bH=Eefg'JHtL>Ԩs1$%jܤϨRtإE7{S~^ * Oqv≔(lvg׌8.7 H:xH (Į%հ?D<;g[;E2ٺ;IkĚOxeöj ywqzie_ĂBfu*d6I%{ޕamV n5l#!q!9w s7]7cDw~K^W,t,#!ҁQ bS5nd++ܦJ $&6#ޣ셃S[qm&0B ğaoXu+}; %J<vнnYGuLHQkER%bzF~>=6Ӆly,SY0ՄPHߒIA]>77i.jw*8-l5Vh!"NT{XoE,p;y֤yzO~ϔI"wKyaPmI`L@ڽ,K=ꍡQ5LGBׅkwQ*pniє^q'/"V ~Ua/lLkbM\ Q0v AOn,!d%+@~:,5SC'5'Esi@GZgcng>J SD,ػ3tuJRvRvV=RZ}#,r-SMvm(~'b#ut[cϮ41ϜqD%Ywc&X5$H'I't#AWMY2e7u=JA(Ymϰ⏟W2dZno4H*򓬤BAT1;#5Ĝ pDY$ E)%Q;|&wa񶈖a%זêBL;M%,Wu$Nf^)1_8+~I?/^pG'x1^2PŃ g':B{rR~TC.ڨi nhGsaKM* CR˯dq(!1#+IB%DKm ЛGFzmTu8n8jlYv5ڎ!<8t)j8VD݆-35ʄTA*) ):ږ_,kd VmY` tG;̶Jow-z7,Z h7/.J!*#ڄʵ݋ &n-~ GJxM31 ]^T@)}K:MQ6 >rZ *ZR!\{uw>VOdLNzع yyojG"[Y^2\\!W% cA=7Ld5Ϸ;!(nW1eJG%0:HK!G' lܸUmmktm5h%9j}9z6)S F&B qesMյAyjJ׹&(k\ _uX! QZNЎ+A3I_bM%Ŧ˸iJa܂Ӹ˥z(9'.bX#/C$j'=t~L7Jmm PQRT'@ =$Z +^~N檈|8ՊUhKQПt<};CJVI$pF6Y.W;&=;_2f❕cKWn_`]A x4O▇,^?*q!9RIF7VXFu]8=ַ((q )ROqW [4y(kt.6梂$qڷGL =_ɢ VNNR"`V.k:4!ʉluG5Q+Y%gR8!"syR9PH8lFQ|-YTrz ^&vmE uЭ߭qq\ 30;F($_t{CY"% ܅ @c^?tKH<|BQ̭}ɾk%\6`#e,r` mX,o[yP J ZjG !30wzHI6):ognrJ&mFG~V[U2_x .4KFnH: f s2fRԘ۵Qs)G/3Ұ~Zf8JBɊFbT S' R۰>.1Nԑũ08p(A&v?cWI|q"=0$?KGp,fqJr(voS$Fv tv2ß)K_-cF鳭"z~vV5FUxJJn48x#;>a4Ò wlS4y8[X+iTx];@$P$ `Gew#sm];Ku]܀Q $|Os۵UuGf[.<]!B OYAMW-U߀=c Đ^lb qLύ{)X6ۖħRowHɍȶ#VeڝT˜z {%_ uI c"` =֞!m v?uާf Jd__ڴeS^LZg‹œ͎Lw un ȍGEsّXekmnlmlH;O5]M1DIjexmwflNptچNڵlGn%J)@RF) IT!9mvD.|ۀ@&0G{R-nǒRAIG7SO!~c'aLyHoH[ $nT;ڗ lV"xz{*Tzgۥ C F[5Iڭ l=7!rnN{}I;_2-[ ټex^`dBLUFGt>zj%BҬivrc?z`ճ8Jzv<ԯ_pXȦܼeŃ~")!k`(t46jM0 2Dn>P6,[!GD*Ct7qc*@cLcw͵Nۃ5ʼn݇93۶(F&`GjOJ2i!'8ulVޯFXMGK[[忁`<\R`gh|!%)|(,y)HR=O>St]RCVʱ}ڵXXFT6\}Q]DԸCS&.ot:'Ԏ'}GٍxS!o/YYZl?xno;VcH=:3c8`R&Yup2Eur`.G\;-b%NMN݀i6#VJc nK}3qɏtqP@ƔҶqi(L jL[nb MI%euoe`M=te2jI46Ô#=^cxzЊU+zA$=+S q-ҵ ) |j-#^gfa#aInlUyU17bs v2vS?:{TR_]-p{DNJ|\)u[QBUۭ :E͖|Aq mb 6T$#~~;4dsM<yo)f<қm/A$*a˴E.j’U=56M z '~=N)+GJ6gwZ.ttHTXzu4{Goq>kqK{Q1MrH:$]&,\(BUI&,mVJ󷍶a6 +Ӯ=}I*|?RmD}=(:k[[ߍۋU"n6hZ Z$wxH*zo?':Yu LHPG!CP A m0_K%b @5iF~Ȧ[cM xu=4'#T⫺q4/c *n^x>*&t*EK[s0:I 8\z),e~Hv2XIB#zG:d|=_הBd>^,=ˎwZVgON%f~޴&yA"Q[?V@W!y3([!Cc|#@ /qPTf-kHsNwl/YuH6S;Nru7<n\ݎ{pJ~=V[EApF=9ܚ=^L^Iu7KrMOdā[@ zCޛG-44;IsJMGW#mCHTq9Mr `k>Ic(Cd ą 'ڞ(!t5R _҂pŒyJEJ \ECZ=qGpUW#ںqYnV rhR-iݓ#>xWۉVS`xDsm *iJ҄ T -} m)>HAďN!z"˂-;bʙ"Z^w6PۆYc-+YZI RV6!Cpg8rCWgq,J${w|#%EYfK <ozL8#TՂI67<O([V1>bYŝ^`]妨@եToQ;,p3[k>3asm1^Ë^0|8ۊ|1i{uDj&bvs׿z6Xs$*m:)4u4\;Jk@" 8i6ypwS*VP$o;GW(M%=xzW%}IDb>VPтA#zU˵|I[ 'I9B|_p5J[A@aU9e)hBn!>^@4bՑ°UkqĠ'{S3Mūd?4g@ ~ğIC"]lx? /x^TE ؂G"zcj;}Rmx]"xL;TBacz`^~mq=7q֠hyA3ls6BIhadsgSׁNsLbLTA)i%v"1ĹAI<թYF/[\*o2@6"q  y H:m+_d6q@[D Rԍ%laWp ;P)'UTmq,-iG  'M)i$6 6 -I-`{1=hLPd܏aھp'}@ǚ ҽW~Fܵ!$#I)8C#Ȧ?d)FG(sހǖO LsORD GjǙCvY^/y*+Ls'p:uM3y bP ӶEX*H*&K; $LU⋪axœz!J Vx_ ##-xԵ8>:}D5Y/\(Wx, GI8364OCXgMYel`x;r*RRS׽Ku'$DsVqu)%R#g %S?ī'*a'@&9j'HF$*n,;|5ضu}7>d8P)IR*YwE>鷹3cuW6N]O !C=߭Alj/2il՝t Ԑfw7 (\o{.Cb bi ;e^J!HKBTQ1k͵uDrILajoK|PT6~Y㓅?nX3 K/'#;Qx}AoY(Z%O@57CUvVql[̬:N5#"!8vʞ؃Oj{R]'<Qq3mZ2r9;$ oz8Ncliw8f<4ڈPÆ?r[n~Ts_WC iۏP1b2@,%b)DkzJo*_6i--CO:FbH xoSHXJ2N*;op#EG')U`ݻsJ$Ē.H%~4!n R=t1a-vj;JIT5+ndTk HWL͒.vEBCgtw \ۧCu5IMyХ.0+4YҴ(JdG#j!u]-[۶-%#q'I"-ÂolZˆ.2Jrt[zM`?XptAI) V?PmsGqᏭ5JuD: _g ^u"M- l`Ht"͉ҡHZl=:%ЯwJc9/1Ц'"=?>S3IJJP69ex {W%NQԬRUbEĺk>HTXۊrBUPjGQF7҆<<6qHAOJnœv,ن.WBvpv曓 k$mLYsxLҥODz)LeR, W&rr! s$;;///EpT`h"xR7)f} YYUo:~SO,]ekyTjC|M^EL|Np.ijv暢;QZcS]:AZHV?e;dUGc𨥱|^,JL k,i{4aX{\<wZF{SMib*9)L&.-.œBR;ۭ %5@SC/{fLz ɖ8RQ <[޸Vy %( AoYtj{mZ[ȃ~5g=YM׋ڕj 8a_Өu!A@(uI#4^O ܣ> zgb*'}hZd B `V9ZZhyKrxThlJ!y~ceVmu "TSY߇ Pi&>UG;6 QFv5=lj-6])4pV@:$I4r?<^q'mu:)*a-=+ Lq%*I7:qI ؔx96!j,DQ=GaAgJ|_nbt-qUoZpt Yw5ҧ/Η:<$<,m-rdhJ;GZuLκ:ui*W0x̣;y-u!DEGya!SR$@بR"bԠj䎳ڜ8Iڣ,+jRu2DBb3KG&~AX)[G0cA)%ONQXr2ܨ'|}*g<XJ UOz /LwCR[0óM?WPx3҅S(QZtT$)H%lį, MŢ|c4fNt ̥rvǼ3eHJ\Re֨}غGф[yl?n!j`ؽEY:\:WD&=e{u{jIXQwצn)췍c9+n%.!^å3>$z/(U4ǜjRuRÿ:aqAc*]c΄ۉ_GPĦ] T~=U-B=XtsRi0np dlW#ːW(XX@QE8 hu&)ntv.TNRdbJ69_ܸ DT*$x-6ux5(wQ$C3WS:5Nimǜtl|cJ XԨ֝hT,U^QNZUz6 ZݪyDnD- ךSO|"I[ {r4XGMT9I65I&KKb m­))#7OԯMup7$$D ;Tw$_1aؽ$զ@;t#X:%3:BFΗ O#e$t0̘c*H]KERe ?A(ۢme0A; {UdTlsV)Zl2Tӧ:d}NqWD&L‹7J=R A2yP1o$mnCnbkT :jiS~NGTGadGo⠎'VM'S uZLJIQح<t\\!e 9ɺ :⎔p4RJ㸒W  J][+;$ ń#_2YVNw0am=s^$˥HNHp䚋/D]$\_n) Z Aqvɔ1T;TONJѸb $''jSB ]^[ JtT j$mxT}GMSHV)rRAHR@Q` t.gv[RUF=4%Trpìҹ$HN4Mi\IKKvmIcKJ'~H56X46>plNB/y(t6#4f;,,Ӎ'`` H{t${"­bƒO?wYNOb$LwBJBiGʩ'-ruX^%xggdu4 IRt'aCW59+>\XeTMp#l)Jh4vtc?.?& i&w(eD,:yIS[C[urZMI tvreD8v[vwseIaqMi!G:e,d% 8u.*-UX7 e-lwrN m35iлwDQZ]XEe| ~շdDPLBIhFdv%c!dS)kcriTS9c-vqAip5bOqKhaKP%P=ꩣI -eqf|t%Ej#D',jgadns1cˀIMIwn}]^liKZSPN:zlYiU9ʗv-e!hzާm[Iܪ>bܝɫLv.KO/-^IQ菢[.3N-qn")c[IIpm&&M?aY"RͽITr&>||}'V]$oƇ{P!Z‰"";~ڋP.3)Յ);}[!cEZ~G֖} LOƑ^U"r/)xtn>n~S*>VV:an饴!Z=G¨`rYg.-V1W#KshBut$k:>Heã&YRPB"5]zw|%h؝RTO*4֔^ٻDY޺ze2y)#:nFTF@Ո\)Doj"=+!ז/$70Vނ5G yeG0AFvv5:0 A~l*| DFxVʒ-+P t9BMTwG-՝o%΄+xLB]N%eĂ233^XʒAFDy|&dBT VP4].Xo=M2NBQ$vMh]CYSZҙLե $mbuRN6W)±eOۏ,#6II4%+GUgfY3-Zo!*z O@7P_ļIx|9z{/q!{2[ #޲ucUw~heų-\!  6W7!' EtSv7P16:/C0H߈ð%oi.<1ރ+Ns},,-~Uɷa%LRTpUK,fBL"u\27ӻ?Sc v"XoZn7CQ/[9& Ot"HeGџ86ΜZ*Gw~ٝJ7/F;c*~$|W;c DžYz`o'vϪcNf?Ssʘ堅Z&>m2p;pMP{49t~ uu|A]t[&E E0+5]$h:}& x/(aXDƲrb9#6^KxPIua,.#n`GUfSef$AU:g+v~m)HHHnMR7!)6,[%lӾt9W|qlExJ~DbΞb,ѝ9kǝYiv5:S$ {-$%Dj߭i1dY6FnJAG?eLdZժGLZ݉6Y b.\d \w?u<2 Le` $H).I 0;&hڄ\S(5"lJhZ$8o-%@P59'֝jahbgc+J$(Z8~,guVaZw3שSduLdnl$6n7<]cy9y*L)*X&I݅]tt%=Etd'־^F^b2Fe?R& |i1!zl֠D~U5sﭧ\:=:~9kIbM^)'P)kɅrD1I77}㖗e^]g3ٷsjDUE;-W#yE*KhLSn ` `+WVTpRyV!W]ЯrL&8G=˧(c8")T(3;mG#WQ;3廆$jA*۵V. J1hK%@ T <:!DzQh 7zO;ԉykSj;fݯNLPۭV䓛ؙ!21qtiJ(Bt) :7u;CLl`똱kNKҘmsW]4#q'I=8,sCEڔT$%JD@熖Xً2‰:w؎rgYıq&7w"ci*ݪgyJQ[oxMP*Jvߊ%a{Vq{x5mq݂SlL2n)4˜[d:ʓu支fŌ:7wxnnnޅGsV].)WīOfUxۥLF8#g߆BOY~bqZH*2<%;QCaj! zQ Ņ؏ ̮p@kNibKrh9Q{\gmvDT V=1SA*D.㋳!eoSWXCBUXWX ;"*qI0DT>eF4"*mE6=3rᖔGQ!vvx'om~eJ +OIܝaxՒ0OM|%in9<*"ܧ:f;A`c?qda!;$) :7QS4PWmՄV>DIP(Js{TZaRRB(v ڧ]]ޘ. |_[CVFOhC\gc,}JԏR}z?(gĬK.݄7qQ&>U$c,j }%  qD~tOPz ca?cK؍+/Nd,G6n[9IV$ FI E^j1}g!DU9jV- Gl$0^[֖gj,u"Mv꩜t6F}<.0hpEOqS;zxCȟ'ضWN/`\G(YҠ߃PxY%˓I{>H{q$ P:mzlPXI @GV?};-)O-\]//H/"*):E1BM S\Cvw[ޢn5:^DS&l[|R4#DCnKH:JcZF38s8`5: sq:Jdld2CMJ)\P23L LS%6`35t =*+krVKh-?*doݸ@ Q.G#EteJU2hQw<0Ș&kY$$iY^ Q(OqooՖEt^ٔ-<;qI_n@u% d>QJbXIud&Oav7ȡiM@☺D;ЦdIKt7_aW$NDʁ#j(F7Rbv6Mۆ<1v)ŷUI%[,->j졸=xR߆H=رoSP$Hc+vn5y%1D:^*͜'el HT pUܓDNS`x'V%Il1*H;n9̈쿇OՐf5{|ȰcP]Ll; /^KEmHKzOZ9Q8=@v1C2nݼN6d/ӹR6I;k%dRW8+͸##L^v!oq+:4xTݒegwpi*=ѸTb88b;NGdXD0Y8+bQxmG!ɻ‚KcV[y W)YsJ݇ցil:ܔ_Qti;Dp^fz&_ 'ERǯrgm nL^GЮoq\b jK^*Yn۾cpH=U(* :S𤒙{RF*<+V pB̍ju?9:9gNJIN+ӰvΪ:D#xN @LOI:7\{ 6gn&zAJ/۸ZBc&dU~vb-G,Yk q(ƟoƤm(Z{ aG@i 9jNuY6π瞆OW$&+l =cs<]T;5smR D{wtCey FU!#3 rRR|5n#A}M[Nń*ЇrCH?< .vAKC$vmAR#zhԎ-h&s y.{-3qj BSl8ޛ-9[$pӭ M$`X M*RJ1 :9-2Jq\dOrLVjw\Vȋ4(thkB 2"*,{1A{j5Csg[lE-@ojg*۪Rg$]#2q [cq5+|0_^+rVh:-r CY̱p&k8<eqC%xxlptm:XZTBy0DoM 2v+?coAWATоgrs8(C1 ’PwF;P:]n*TъZ\ ToKdQJ.;myLQM8mX'zEV9*W[Td#zFU3-1)b7;bxq8R "G}[Anie̐ѷ:Qũi[⫧ ]B߈da+#dI>#cǷ%([%F[Hv=zT@IƄd'JrhǑ4ؙUM,O&wEJr#k~פgueXˆ2y{P˦XƼD2Xe[u_I.O$q4 5,o&3腝1dJHe¤8"HAQ1ցc5d[F |eZHIPA|qNu-^^jsBɜ^д_UGh8M3m"Oa+vFpt&4ɣ7T/ꚲ BL; PH< AXY_/w)~+IlvhXiI-"@MHUy"bHq-@ѕoȍզA y1RZձs[g%Prh~.b.>PDOý.>0u4Nz#~jRTJ秿z(S%w[x`ȷ^[ՋԤvnTB@iY C tSY; u)夤cIۙ GST~7^}Y^>\*7*nTx(^݆䖢:+?Oǭ襷 +`*S: >X"p[iBvJ-[G"D&]?obJ7''ڨxQ$ #Y 1IJINB3S Ve7w$w<"ge eҴ2㠝='G|CIo.[-3I$IiA*mL)Q 3];+tF 1-Ζ[ݯBBz&Bn($HlEos$p=\e#cd)HW)*$|Uץ^\^ &Ća~jlO@{^j%{0u޸UGХסǍ?Xp@uX!:GكɎb!9,+_ i T TTѱL [okq C쥝0}=,aE,F0OZ'=IIRϧS[;<QR+[zuEn.}ɉQNMٱ`ފftMa c7?OE)sagYbIWq+20럳:SmD,z{LlK4.= LqGǣMo4R(m5Mx~Zy\a+g/iwkAE&Ӹ;[&ݵ5"͸;M2J6WqMC7X \e) ة@uPbt1b~e ̺S.jp2oO'Ij/:NO./Dx%GB@mT2ZŝvWԂ s9d1q G;Y$AYm2gZ!:}ڳyӻ])\W VXkwiVиGӉ8@ @N˿GθnUQy!>}Bj:v)~qj.݅LXb.! PI ⮘Eec+ 2Dƥ? xTۓ'v ZIdrKg nUn$%'=@1I$[).7B XA\qۢGr-*w q|h˷o j0IEm4-Y=Lz*NGqjx-:{ г>l@,j"c+ZK2g=$optTzQxH 堼i b֣ŵZ[WΣd|ҒsSrm{>.Lr Pc_B%"yVJ=|C%Xfrŕ!)**a㓡nzwDCƶ9m>M%ܚ.H5 ۊRxӡ"܌ ĉ-H =A/z뛛Oi#Yc {f$cRO~]W`SآVl{iz/cR{lkԉ: d~j+~/۴ViHRLo`R#n4*S$ FΡK}ŲB6PI1Nh2,CNiC[CkfbzNeT&6$z~t$u5>%-ΘJӉ fخ#/UR-M\˚A M+;-ըcAw"3؊JSQ',At]--\u8$u 4%5hz; +N¥CZ")jJvT}#c4WBD sFh5ڴ-ll+>5gUKÛZN*07UNJ'"aGB`cV$-Sh^*l95+ce trOT$u7?_Jzh]Ts\Q@w=M!iQ6tq-,t1^m:=n1݄n;9a,plAv:ߖa!Cmt/Rb:9d,Gkq3 uVS!7e*N Q*tҧr'd9"-Pۉ )mEhF6#+Jol9c)g<Wv)O(RL(&;xg $‘lWqŬiJT`^&6? ZpD[2B}*R$F@03y(ZSR96]o:90l&kŢ@ tƚpq zL*EOq4د0ç~wz9F𥅒IpՈʭ* CP8)N4{s K' ):f ^Rcc݃9ɹ_{HP3Pۚ1-:2ƳVV{/'6%E- JR>#myK}Ǜܣf/Pm,#~[H_4VxwNKٻWLגo;qnJm5}bm+؆9bǛ]eKt/A9qb%Oӻ ~ )NsȒo )}LC7]3 =nSWu9[O'r[d)GمhspVAOs5!/m[KiJO:IwA8ۻZ W$U6sI!#sSKQJg4>%oF=4:156HQ1M=#h?hcZy$Mr9b2-}1_>9r(&B6E9I]1<7r?vK[bM4Ԅᓻކ|07> Z q/_:R33(-:ue<^v Q%v (jTtW86;\:f,s^KP"bcqDޖX<"gkQDsCM14E"RUB e:wӨK#㦰ϪJu}j){- ?~A q+E*T=R5cXRR` =0|MT=*JJ"Sx66$ SA v>Qڟbk]#RԥD#p79u*$IF-Yqn<+cH#ނwI] ۋS ʢHލ_ѵb9kS{8Q3sō$Y 1 ]- iEA|AY{YVl^lud,H "2dr lDݒ̝Lܖ8[>imBAsӭWVɚ@>j~酝KNòAZ\*|~I`do@..qs{#;:F+ڷhv3Ŝy]j4,hImԞ9T.g)A"C/rI! ;oR"9lk;)vZaGjдhpܗ_K$\G}u;$H1 sP sttmfԶ~ڨr|E{=Qjzjز0^ 7(U-;7X6%1*t&e >yD*9sSvRRHT8z/HD*)m" TDeʚC7-]xKBJ@>&7 :MLpr[sqP3@Z [Hܧj~uĞ0ݦ v/6*:ByoySr)&p[xmIITA 6ov1orV fZ7RVcQOq;o9 x7Gv yWbҠu/QJC9Jش`y_Y ے41r7id(rйZHagbUχ׸ܤP1Y1, :JS RɊ%qE@Q=uro(R lb6b zQL]+YIuZpo*C#5Q#m!R`IcbWw9*9:̦LkweŠyb &N,ec ݺ VdPY$XnDjMB HREnaiԏT\6 )@i ܉3ҹ+cV쎻fnN*`)ҴNPQl rGW$jD%*Jvܝ&F:$q%T=㤉ZڥϙJoHBe:nB62]&yC²ʽX @3Bi.pqW75@2U)Iw'c;HM6D1x&6H\Hߙ~(&sGnlCjN n>bp1cWhVt{h#}3ˌ.^*4(T>.b6T?zt'.7G{C!bRHSbź@t WKQ,C*I$ӱ(ykqsޑ)xcdҴ) }2A):w4qѝ/+-M-"R$lx%o$L^X.)8l笁*Ԯ^ÝX%MJ%m40zA%)u9s\@'sNM1(/2LAʎe4n|)#qlei[.j-&ktqn]!--,n~"qZ^޺5>TpNK9.n%ŞҒ̞h>#5Dg(Sa֪$" D0B2H `LD 7+Aӏ[8L5(JR˨qوb kװ?)HQ+):\X\_ڨ6ZN*W͑- sP&rbS.nL${-['?JLoӃkD 9.#rV4PRd 1Ռ$ն`mSs=8w-%J?9Wz9h+湳.&&#zv}&{=yo]Ђ1+k"JnyAŕ-0?(l ~jnLOJwoa跙Q iv$2挴"LDǿ_ lƼ}oard~iM=Z&Uެc".V8ތyC=ԥIc=[ :!8]J^Hr?lo+ \G /p>%M hYVV\an-EJ"W_% Q(A4lj f/eSt%<+k9yS,><4HB=J$wVZ)\lc>:[u -AO΂M[:lN j~TZm>BG_c? }2L΋tIF28ͫz>E(gR>-$o1ba7}lPCRN~If|9,[!:rOznYiOFi?79!m\C%"=$@5ϳD塂WFcu@hL0#r"I'h<5C[vAگXuPTR "gm 50g B4pCP="LG:QlMq,i [[vX|z1qT$MQsspԈS"_vqi2IP_\H}:w\I\* V5n5źzJCc. MJ=&oO#X+4T[lFiTt>NJAs g.>{S"W): ~kbEzt)lJΝ; wh^wqr9E~ аJc~}uOv.qWԻy;mjm!~Ke8*R ܨ CQ\8w<;ѼEE+Ե|1"Os_rJVW觪S<OZ.54 RK8uI&*h=* WJvHu)3MlRsU.HMK̦!{8I8q]O8dDV:`& &5Q) 'ERsiHLSK9ĂNGWPTiЕ[>^Eg yjT#Kq idCb[͓blcNben"Yt/KބKէD~^:fuwԗ]m埈82ƠE8{+Zԅx ˁ&TAA~\QSkr#[2D$'`މyOxR@ٴuRfD-bHcU3IW%:U%*JS۸=\%qkZ>R5bu6(.4AZ"7&Oank̤Ļ奱tUvwi]7d/|v">mOO܇vR6=F׭BTDtVE&)w@yvI- 0BP'52&Ým~rIPԽrp]שKm֎ TK[lvחn.`nõ-fׅ2`ӽ?VY΋mtyJ$(Ξ>PKmJRz<5#<Ԣ9ʗGGՌ9RH(ܦ3(6{~ukmg$1ЮV19zFD ;ݟ)OZV!a҈NT̥GFp$7ޖ8RmI;ʲ6&t9p<ڈIGalrrśv YY Z䒐et.b qHZgr#Ү+T1-!ӳ:yئz1U|4b3 Jw]`wIN/'Ln6Y] J!)F۷5?Mm$Ŕw` ^"8Q)Bf'C"OOef2 VPJg)ǯw] XVV*Z\QTd5kv hvG]ʜM uiP"ebM%D R+1kE۲ (qK2.1y\iROM$Ej~n8AsZ)HktEOM!^'U9=0?wW,qN4 u. -c }Zn` x\Ic5otR)mP>ۍMO 9uJ~Ȓ@"jI>3(͏R\4O'?dOMdlp]L*e3ڳK}\&F?7d@[}erKr{j=-NY-pou~KDDsbqmp|"3[L[ôy:BSa@&wwT=8ZڥƨG[o$&Ȋ-!/'d~V9˱fxm{q|+JPirzAu5v@EK(J!芵puIGQވT$+rJNҚjӸNJ>SI2HG l,sUBO-JeA" ք|X }YNEul笞<)_g+[L'M~44-J\' LH^qn[Lj2hCJd66^T_n u iw| \1E˰g{*)4<hv8TΒz 282/eW(Ƣ N `_!6;$A;R!}lr?/Km:l1el-hlamWbe@՟7QR@}i\r_%Wf[5[ W:!q @U]OID;2 ǛJPicb aASDE,̩[rEsTbKC1hkEk xu= fz}+<.Jv$v##$Ɓ* ڮ>#tK{wӰĬWkpԢ`#.cLQI4'B(T rt+Eבm*xxZopAK7hd<so\G6ŭ\[,jr'Rv#4IM8l^D0ǂx%X u><__a%$^ bIի}HWaU=NԂf)T\cgFQ3ެ-/%Gb7ֻU&mk`$s?`nuC uEPۄۄI$R!l}Y7(E;h\6Ď4SO}m,R([s}Lօ'm|fsjٚ3a.]z.%BL xIwdS?]dp>ڴDJ3>~ƝK?0ɇ/3rmmMJgoZdV7JS7O$n|}DAP4pXq 2L-%F6Ɉ:76hR)* 2ҽC\-kZʔ( $'ָn#d(XyOq\<?7 Qqٔ)N?y*Q'޹:;ǜGQ:kQÈSK)ZN,K9n l /J6NBw"k$.lV q \FTw9c֤E.(h'dP!TM #vrX>HT$&i ȻL1ÐT ISX^7vw'륿lץBUp}hP1[ۖ5b &y~N"oC)h5юIHgu[mRX27n4[B' K_ S#ZNʇQݗV@{vQl qjI4)էŤIƣbpմn)J )4+|XP@LTICU.뾂eRC Ȟn蔞@2NDwȵ})":S"[/?q{?*J:TA<qɦ99 -VR =Ǽrk9oOLO q:I=D'p82c%_HjXg- E6N@Qx|j9%E._A A}5-Plma{M2GFKyO@b-XJr'J(<L|#_ݵ,i i eO+0t5A (nLڽK:>HP.yOjvl )v'[4*V~ ֜dveqxC5RRtncii13ϨR㳃أ'FװTr,r<ċ]R$a\nIQ:2fKaܒf3VbtL4tcCX =%W#B@|UZ$؂.^q};0/q[Г'oġZLqb,GO : wnݳʉ;ՄaNRxaa\'x8Mw*ew3hBm?8ߥXd0mX5œ=FʣχDRE WXbm!I #hU_b^[hŅ\[5v-kPP}_cJNnh[i?M%J 9˧S{%IP{ BÚ\qP(4-6Vc^ei$p}{U2(="yfML4J" rÛhB@#w- MvB`I▵ {Mӭ4sPBחn5k%gB)c|*$R^E'}kR9)M+C~hMckp)Tc6~4Mf)tښ ;sA"} Z KjC )/⹷Sе%4w÷DRՊ.NAX##8Z}a*Vs-8bT?QM%/ U"{:=K[BxRasmės8[XJRxQyUm%&1j2Oa85ӈj촏͟JиwMԬ*j&qm+voX T {Vp,+WE*%,Si)!1eR>,O>"+|`4DGeO"i4!~){aD⧧@q”\Q_\^]Kz51xz%X^' =~]M_q]UFR8O%wd5ώ8+=R$L#5]ױ@mu†R&llp˜)i}mP#2Ql4nY]]\yL -RcӼȍݲ9E .Se@rEGpK6SRznZ P( 4\G"K-0ELRc$ړJI3udѕǑ ]_&iD$6lbyF#Qn:? ^sZTx }ⒾĨeLk!^0i=Lho7mhN+O觵 ؎J؂]i} SRWdC3IJ)Kf;qD؏PSt;Yr+G4TEX1s?TS$]K%W? 39KsURL*}%UT> ө[A 5&|TY>a65e)Z0,LT 6!n\aH@StiGXpK-nj+wBd[]êm0$3I"Sg|fbMM'[a>O~-]Ɉw4= FR7pj.J6'HJR,:t'}mKd(-H77x]~<@LK,\B$~Aڙ%mR>K`FKfF n_YPީ;!QAG* !>ټ t\lh- ҢFG5:QdbekaAjm |ZSS@&=֋!^w[ ՝mq#Jsa%du"rK]U2BHPi46^.y $iT-7xm6ͩ^* <{V&I$-r^p̘CM _Oq46M>B"}pRst\I. iAlO0KM z?Ku/v ?%BO„\ fJj%*G_sj2ʾZV%$JeoԈt9&>Qؗ/zv؂[mEہ4(A7\Șޣ'&"',fUUЂ_KaAP K;|v$fkgkWC E_\/], G7'RS@ څt& To+9`J!HqJqw46O"Su~)(C55qx(I8tJ C%u GjQ&丕%]*.!V#!OC6MqIQ) NuaM[G&+izQXhC͎6_B"5\ZB"ó,*SSdp=Hzs4|`̙R7+aLb['me: }1OgK[v];)e :Q;=7U]BwDV[3;dқP歀_[hLA*7˜!ri]6]%7+}R ,Xr}q-r,jnm&7`.@j7V"v[ծN6:tj$5ڴk2HMAPQ"*G*!G4 B})Hi<(qbsԺi|݊=vޒ6M/_Yp*5tqB$0<ڼ3V4帵TzI-;9N ƻb*':CGxöJ"i1NEX`Lsg?A~ǖ(Xdq? +ՄD sڙPDA1{Eղ´A=kLjr YD7>y.67\yK&h4Y?okfu:w>CA?/o8EԐLsXgQ_t~=uZRRI9~N0[wȕ=5:Hpz}Eo/(p!#~rQ#ɏed GY~/Dg)QX]a Ă ɦoc:"lo+IB)XJյ5;$N_h5*@n1o0ަɰCpO4:NΫl֠oqB ƤC=t]8BqNoq ld,&5^IߙӁn j.7*CS8uڥH(WHݝ$(y棪C$'zH~sZxVN-',UvM\O46sg;RWp#UavNsɉMɰ c xLG߱ԈRˁ5|(?/R)9Eqi& w"l8Ѵ II g'!7BHV-=ENQak%!$jv>o|mPօ ?U |WcKiO€J s'3ϥĩQὮ;op/I\M62گ%%k"aJmºz9 ]R7VԌJ?-nJչ4))m7O{s{xAXIЄd)QTqAͿ̑Bln^$p xq𡲵c!1f,IHe,郧PW~ҩ!~sA&` \(AS:uZs1OC njxN\ <]Ş\ O_~V M+ԙ3ձD sp0M]6xVi]GAo|Lw++/6HY.R#E6^7YP'T"nw6wZn0 ڠ.≚D00TzվZyF\PkRP T^s{3 .4Q~Sа,d6x^>NܑT5H⢣URwӬzV{: T^Zj$uE7.5%?aA r@=dPl`8*$HUK+MCe;XJ^=:gkR8Mo߬!SrM2y7OaS-Lf-A m0h*L~cjݷ+VS7{qkMw#f۴55"6AGVHE@BN¢y ,AQ#IGv?5ݒ:F Ka(M6aę\ËI^Ob[ٖ3z,΂}^¬:,岵HTj4DUȈڙ:ޑu/ Ԁ%>H=yzmEm85*QL$D(BqSu߸lN.۶ªQ2psqEKn`ڋŖQ!5 ʸ~KqD'~Qزlڰ,xl*ɶVvROd(= >lan0{'-<8pHlP\VڦN <߈2l+O-6i)ARIY~+O,'.-\\G;ҬpZMw˅!$Z҄[p It6(NbkC(%WZq9JX0t5e j@T*|RTʐɃ"Z.C@u0cSP ; Bd141N4$HINC#8eHgzȎ!|IΆҥ,Af?;J'9mVR6;4kBÄ))ڬbǕ)l:1ugtV4"H﨨4"GOy$)-%[m  $NuQj$o{9~c(ũDQ&Ϊi)Rp%` ;zZ} Nn>-X7ݮշnR [͍KQ DYN8rO{%wϲ ǃT\kW`Iuܣ=4V\?@o+CcR~|+=%$WYp:uz8Wnk?tq3Hq@Y+L R'NIw2f<6 cē`7Rf>tuTg#q`PBTDLl+rmXZR!$Ly&hܐ^?K$(*~zurqJŤ;!B "X 9ßBRϔ'cR>?m'5n ȂDܦz2& #j^kCN_+^'mG¥Bzns~2>k O%+Z*ayt"AIyEO$ǤL&qEDЃq14,C T Sk~RB@?(&8[iBnu%j]Esyy[3xÖҡ؏cM࿎W|b G'Pz'N}#+|-6]p%TۧJʦDRT@ DcO%:WY4q]g=V.)K4ʆIX{z-]7 @S񺕉5jgpJ#[TjՆBbM)(hO%؛~,]n?$ƒlqI;6oXMZ鄋mKi2kEOL~4%;tY =q|*#`d|*ïI J O:@U~#)EKܕ܃q rcGN;Ae N%~cV2AAj5 jz냛^"!E(\a40wEh|qt;Qj:`؃ *ЈPPddJ+2iR$UvHp/ń[agGP [G U.L~botfϊiV]8edd}UA~ EFl-Jӟ ݱQʹoMpt R>Ii5k:u;U%J/8L(L|jF5~ 5%Hۂ{IEMQ -'E RxP邎[=)BH*&H)S)lbzӣ=I{7ڸ)JմɎ/\=KsPH)2#&k(V>1]bQ6`@G;E H|fVZViByU2ҕ\%!>hAYJ$~Ҽ&maQD ʘ/㫵nhsJJR!G[I4'c*廣I>v${դuq؆D#Xė|Oqa8#?JBt؉L-Y} 8B$J09$)tN[>#ux>_Ư,-ʖ HLLLC"]T~t)?w8tjXJɟH}&Mr-öɛu3b yHRUJMjjw{;V!0L/, v˘ ]c@KϥɅJI2T2g~rjMIm~E㣖WzF r^'盜XF gj]EPHa*u nҨ?`SYͭoғn>}0Ooo ^+m{vl>`PSn ecSk1ˆ؎k|;]n([^zIrp#N pt) OvՐ֨t˼VkFVΫJm%JQ=OdPZK$pC\E۸hIh0W%,%2OTNVv?]<,iN7^ e[JoZrpJqcj1\qf+G)=ǥ9:xzL BX eCF@BM1:גVĚjږ)JLfvܩZib]B-C sM"Y! ӓ1dӬ[;PuP#8%qV8}}ԑx擵6M^In2qGBUS$8\*lD'h;MVZ$l_@PsZ,q: HU:Аg}ȟߊʎaB 3 %7cH9lpqa)&@-$uihZS` c(bjp$DnC}9Rc6Qf:7|)#ڠq4)+'cMKt2ƤD(8<$7g& e*)4>?}Zv4r*"M# u7NǖKw'զ"ݑĺ-)ɮN))Obٰc6CdsKAKޛ.kizl{')d: ͅFA'޸R a"tƐ%kW ge6bMqɊ[װjq}=봧x< ™2Ҡ`s%$H;bM2 Jwf6#Z|Ċs[yI2+CӬc) sQrr?goϭyH6*B]үOŎJ)KͮDcZXZ^$jA* Ohwx^ߜiIБCsU$Qgrʯ oۥ3nJ才1\GYc\WȒZP 3Q9Z6z9lmy7*O2"˒5 ѵB>ʧ=K~z6w(A*R8&TE˗jX ;iaљ.-&:I^֞DZiyג6=nGybX ٷrZ$'Se:Z߰`K[|KkiZPG5c/' m(.R 29C,R<0JKs)~y9lB<>m5wژLw[H=y\"X͹ru3-APMJlir%5~^ΑB1 ogFixymvA؀y= 5SLoIg cLqKJmK>)%#QcC+M}ǚ9SvqfQ3? jWŊ_ٔ2IvGTXxF5}ʑScEvެKv*u9k>x<7dЋT6S!i35C.X*uT´/UK豘qV.;01r#o0'dI#Iq~sSb=Wpo[-ӂAn*E*QvtpA)ǘGԧ/=)QHrTt5 ?Riq>X>486 j;*~*EnrB)u Ę2SmehVg#t9+8b8{{ ,eg5GRפs~&[igIJIGV!$Se#vFrRFPT,[*B_R)#!Z4X)0RݳIҎj-:C *Dܟ4H*QVQ,[$}wi5_Dl]%`=m HWwgPRQpj(pG$e.[R>B7ⴡI(AcϷΗ;i*rO#@-zw*hhP(~#iK1H^hn~/6HIny.j,l'mnR{v 'klaTNt;BO3ғtHrgwvo0!-? )2Ʒ`^{ې)胤"q( i'#BPNq-1ѕ[i@'~bZ9țra jTHY;?5T uzU$LGw;Ҧ|FFê:*KvzkYLڿptTua#*)NNAZT u[rv7ⶮ&Vi jTLiÚ$O8|ůqḵ% jd.H9nɝDؐ8ލmC=O'=7cZavG9=БS?:R z8Y1Bw|ex1 ]՞#ij7 lzH߯ʴaGBv:a#z#tJ2[xu*0 Qf2D×}:}:D;X:ϩQ{+^0 9#VDǬHkQҐI;GZ.K$B7J/NS!'(aQ()EE&ǹ#d ]byIJIY"P檳7\>HNE.T)H)sL Jx;W-Ʃv!إ.`O8I ICO$ONԭ!Wby(EFR;Zݔ*7;UHl*QXq +2Mp+WV{m+YT{P=fǹa'-8/Wn6ֳɱ5^oŬZ0CoZHF -[[H^-vN6F!h^M)ZV&]QG6̬+Lf@);(V1uLPnkmhF?2ϊ#ܰ"5mք HmRiLwtx#qN\fogIU> 1ZGmXTuuGzY$9SUH6ڪȃes2\A. ! (Y:<q)(TrKP|T/ <;ɗ \BqDƥcU89Ӛz]|KWMħTO3֛b(CJP`+qItkΓp㭵*_M>᷇w92[{R݅E:gԕMf:TUīZi?+Owv Y%Z뾡v(PRM6!I+ҼQF.)Wu}:^ 9/ÔPdtQqE#*L $J| oB]s p Ntt1%-NËqV|F]>)`n[yiVO_e,ƻ|F~'3߽|٭Zk:F㫂T3[>tjV~7E<ߍR utFNC1x*K I7^kBdշ1"Cjo5=~/'&fwrқ\aI-(" Χja*:?: 2?V?; $(`'[a,!xs4QHMA) #ڒmIt_ )z{/#HLc,eĦV_0$a(oj\@=O [=/n3qpb83y4+V-NЀUY emlz{/_!,:/[֐! `:y5npK5.\s!*d3{p̥i>w5韓ا W'z.:֩Ϙ!p2*9HAڢdյq>u?[DmWyOMըVӫyKX2Oj"*bfqЕ$@U\դwQ^+z`HG=jsc֗hqQfx~uoIU~ I#&^]HJg#IX?SJBLOn6B e?:N  UbX6y iClR oIƎilңlZ0- P`+l]. ߭g:N$Zxv~0c$@N;NU\wCӢ⭃X!/^u|?%?1(&.p7 *O?^dx,&u yKKǘ$m'a ?H!쌗w3sPSAߍcw 7|obZ|]XaZ {S >kc rQnԱz]w-y7'iCHj/ZyIǦFt:DNL-R:[jHգ_<괃DR;I)?$[VŽ44dn6pW:f RAi+_$c$xpǜI+!^R(lIQflabZqQ]Ctcd6HJбMW0)Aw>ka૥ ވ,'ZHs97p&F˓sVL"9-0A .v+Q+KM+hL(:$ޥ=m[)V(?ļYPM44Vg;HF{N_JzDQKqXE77јG[bnJG&!FHIѻ#r;I[W!BxSJT*":\B% /*i z<ҊtA\ƔBahW#ԣõ[9`S_6oSHվ[*rJw;zǥ ;mꕦ4V\zdU,qiCkw*rdpU/ObpRt!)@WpZ ?*s;m>BamQ#Ùs ]GmlHl^BwUlg9ڝ>[3 SҦTƢ"4o朷?r5 RZ2~bS)wV\O>d_ac*a|*]q#+'\lw܍2(*%pMސI7yGp=C"{n~1l\=@$?]:*H0ju%*b^GP ӏcQȮx&z  \AȘ޲:v'~㗯3~] qL#yN\ >Pp#K#9V]=H M;*<#ܛ[x1KU;kw9 ? gSG(C_2+IY`/~hZ/wAq JRGJ[7*s@I(lXƼPYp2\HHRgxe'$iXnqy4#'I2Oe-U <:k" [E[p6 =j':ydm/mc~Y޵t,-0Tyb:_М]SCf@ݚm [y2),2G4vi H~su+WϵVe|(4;ZSp6B*ArB: reWS;TԗLv˶l▯y \OS;ӳOj0n'XbI׶ބ+yYvԩMXM)&-Yk ͳJTvYCvDT6b( Nދú:Ց\RCY- "*9mQK qT6mӶ[➵ePۄo#K,ۙ1Ln]䶶BI25M"wuse) $R10ĚOewK˂{l)x,.[pz@ZdHރ$ 8텅Jm:OTqcܥ"s^g*FߦJ*1;bUYryz)'wPc1\u[6<Ӧ|)U:l s_6lab>5exEm\`!BOӼV;KFHJ-RWs+a.`lcHSnдK+.)SƘ KeR  =|spn]Tu*wb!x9)q+d0RmQXNQM[U^Rǽ.#ë-b\L<6X^.a(Q2gu𴜡vt ,m͹uO=b I,"; qNQd7K{ƜZ%Zq\Ub JTkIDIqKmim5ؓ^=6hs]/rڛQciU/E,3'Nߨ.wu}ˣ[ F{B 0%*QU{U?b_ )OM\%"Y<ۮj Y_%3}pZ %iu'+qchoc/B `f`!a[s#p>?1t>nd1!ǮFHxZ|Mfl+Vw'}lθE#X-ХjQ yCZھtڌ A.piXym9ޘTbrtGZk4v% h֘z[ 驸(2*֣i FzSA֒FP6'% aH@##pKIQ{s$J9VwڝCu?*`ĥ~5\B7P JAi&RNB8 h)hiه.  kt=91s9ImC[&.+kf &A#څɍmK9S˧=H_#je? OL8ε9+:Yl)h'7zEpF} ]g2I=6!dl ;QHlhk94U=24tұ#|"4-2pDMX;I@fQ5V,Ev S*xd2'jYp"z|qh3ϊXc\}B &8/e[ԩ$Ar-i,Q]^in?>5G%f ˝-. R>Gߞj^bz͚1Gmzh(BT;ri4/*]3ZT$:>V MW6\^Jc.Ը #qN[.,q~=HRV괁9%Bl+ 4bj&x{Xyx@z&iMh[.hj\M=+WSQK(Vv$ܟxˊE媓M".Fe1>n"VS'sS䖝r9a[ӀU\zcJJ6IOQE{ڸVLlum/pma2)%[&benFsA۱ccrl&EYJ:~)Lp VpY t4+DŽ,>=GGŬx;XC Z}+:~l1S\w>$c-;H:R T89<[tBZr}@ d/!:j I=MI^ZQH>]=Ի!ji4k(\z+Luuf Nӄ4zcriE+?>N]f)4 Ƥ$qOWcf,]rX ( OA[#PEgT_(R\iaIHBl6PfΣ4jh46l[+a^̶VxHCNƭqމ<M^.`p)րe'b O*WCOsjF~{% 'HLuHb{-,َdÄsWX2I/zpWd[ lu!(JGߩ:lZ^ќ+y!'ޤ5J|`ʯ~{6 wUyKr8KR۵QkjPCm%SNIUNc[$$=f|6%8THH7fXF[PL> ^%7#BHmq>զnzūkcq[\)*ٽ#V =oIɸ^dvRn/+&n|UJN#wK'i5?ΖKڴ+}cPxlY7]}A#Rh %^O? dž!ཤs/lNJODS" (qmpPPfݎ,ݸceBV,7C%$jJvjbPt[[:rOx#o,ArUYbK8.P6ZQQHJ@G{i#W}Z{ٛN:]u~cO:t%ZA$I# tjTI?gLb߯`+W6+K֬BZ *>'VѽyRrMZyu*zs pżï!-e*ԓ 7$usZΣ4*}C// KFMVVPteGRwӭ2;KmAE'k~U«,ɂ)lbau6WRHӬD+ec7+n򠎣 vbyj@;H1=;6M-FU5ٖmt-4%@Hzsw/[!G”.~t\gR|DYLrR>9rM3aa4i2H&KgeG[*Ρ9-2:{}~M8+97f-lQf =.wA*@Bvވ?;[Is%޹On:Kz_? Cd{uQ'`%nKh[R(6J;Y(vU ~V^=<_j,/ |; p]]b }(O*Y܄Jl*S++4yjov 0//;si9ub)\RYnAJ< x~'))EG:ק+nB[<۰=o#KbpF=xOsHH8h3֚/$Rbn$8XTkV+ :9gvn6'Ok`L-} VLN%t8~h" IAW>2fj% HQl}[h--r3u[ZcdߵRBi6p/Аxb}; ; MԷAawOkEo#AgBztDB[]7CXպ[)ՍC6>x-. (==e4vhh\.eSy=%l6YiiAɘ{-&ѥ(%_dU%zD.XK*ڴA;mw3T VPtQ'=QM'wJ%l#8-MJ ;*òaS~'Ļ ɍf~z6 OJEPʛTȝkiuaI5G'-}DAlE=6PW&9n;"~GUP$.'vΊ!E5dme@")4,NK:hgQK/UҧCO-"L 7vb|Tɮ%#PTtB '#LK[UCɴF؉zdO [bn8*iIphp5GJPtбQKfSPݑ7(#N|ԡ0:RkG=&mJ&bT͒{u-2 D9 ($y-+p[2)*mi#?\S՝ FI:%$Go\ᬐh}iRFӼQ0l)͆˄ƞ%7&7dt-vsiRAa ̤):CZ&?u6Hq/PȻB-́֝CuKDSB}4aITS[~RؖqQ4N]c4Ө[bx'4js `}7OLQ[ )J_ʎjrv4)\(2 >;:=;SHFz)%#Z&9[[h* ;&%Bt8 }žK"SIBͨf!G{u"5"ݩM1R8y5CI u(k:m7BOP=|Oad4AbDiQlOQIu/ IPY;{V!ĝ c܋?DpUϒ}apLLݖ0twK[弱9,((~ꫫJSTFvas)!1:FxVYJ-H`Fb,l *,ZwJOnB.Ep\I,^M"?i%1urqԵz^ /4_wRHS씉Q ߀q)hu HRe?ktywFa1֝¶H\vRބGD}8.$VvV$Fa,[Ԛ+Qu2$*x_|@b%0{Ϋı,q4"Ј5f \I rGy{ר z1iR#m!l(νGIhqnVd|Vz>=`)ݪ&ৱKQ$V Ŋp !Tޮ2Ni 72}TQb6 S rZ~Tc"A}ILb8#j縇-DoO[ v^ Vhj^n5GHYO%@>߿Mȴ9n&|\<ꚼImmm?z;-hf,8DMfTK`; V) I֘+mW&Wc+csm`ZuzO9cqPd1㒋N\!ڋ_{ʯ9K2ޤFzz{v͕O|dmтc+SNƥ*Դ ܂zQֵZtſK{߲W *AV{ N=Zɳ-[ya),Ya_q^NZ}p56L K>ȋ{m ULЛv E&M[["uqܠs[ڰ^C*q$ #7k_%?`(Eqjmĝ_'V:ǸdW匴mЦhR-6nv&HUJؚHK8#C[O:r`'6VXXpCqRDUf>KKmc;k4"2 *=&GV}t!T8jW@ݽĔt˦';[cLVUeK< vU/{3oԉb_'Z&zNljc!QCRjmA[n'ڣUȇ4Lk,b~zR@i)=.lx[%hۍUŞquxVnA3˒*/hl؃2) ;I eqDK&zCjejթcЯnƥ Mmkqb&VnoOg-KhxJWC.p4 ;xհխmOQ Pgq[}%T1K{w( mdOavIE+j$-⟓^HӨD1~-~!xєk[L3҄>jZ5NWI%ptvIKITG#Ls!qKV̚Mpz$¼j08$SEbi-ȗoY/)ڥ֖䕻KRvi V+*4TeaΤES*0۔e6ˌyνl>\4~ ^,X\B+t4Kr{llj$Qj94N^oMlZ?rJ@ %Hԥ; ;&Q9i,V]kw 4i#l˾I;p)|RJI5FSɪ.$=8)o|P.xd̗m`8MJSJiF Т|N I(l_^Dcָ 5=Vlqv{}omq* 1S0ˇz-q-bl JTR]kL(T&7a)*tkWM1i[׺O)ϙsO6,rĨ\$y?e.IJSSzkm 2^;(Lemҋ`ۉ)#g(VW+֤Qisw=f|ϑSw7+Qa<7:H6Q}7M$NroWɺ|^މ (?n$%R9#5tr_nҽ?⊿3Z'Tjd;2P KiH(I!G? P᧦ocqڷe|\{7dbWnëi@\8VR'fZqj1vRi/K|2pW坯Y-Qx-&nivCeH@)P "7j"'} )ﲾ_c7|VX\f 9QIץ8E-_d*[y-I?D))/_ąq]U43FN-LYGQE$SXm>*g 8_mZP 8uL9O.Nn%M$P"rMa疕jA{+M廣0aaZ5wzS+xz5a {~&5d# *l;MDlM+;zYQ D^hJ+ Fޗ1,e2j)?C1nBm hs1&lEܵ%n ?-uI; Hoqr>1ձэꐢN⥌4F4!yj&Vsn ` fw SJ$zmA NLw; PQEGbz+o(:R:cG5FTv#C?A&Cn cJK$v#R՜siQîipe ?Pi:TޤʨgQ M@"b6mbzv4{` #=*U+9iw*)GNf :!E$n+48iqE )&CGUI-&icQJC:҈J0{ T5Bh/QVF?]bi(S٢_Q4ƇB\p[lj]l>qW9kw}'@BB)W*LxV}Y>ăY84Xx)f *Y8kRڑG񉬭VoH1[leFKXmHnQHRt#;T5M7bZҜJ ]y$$ j_R=a /^k@Z*w%XU*@0# f6^ZN)9Dݖ(bl%lԔQ w&c.q1t:@cVܐ*:pꌬe\,i\wݯEUپ;TKIR¾Cx|Ƿ]v ,k#Iu2z{|zJHu-@1#VуNXCܚ8[l S;.;rB7'Ϩ01;R}H:^.{V%/*)OxtOK&ԢUleWV!-)OQ`Ջm:TU=(%kn׹ Z]P;S-i_b&|Cm iu嫑Z!6i~][bI; n< iviJ9ڝKR[l"m.TMV]OVaCa|"}])Fd3fKT)"jRJ "}+W̒X[,vٵ:iƛVK[LP)=I|)gm|ŕC#&:݀[NnIL=ݯAdoBe (}$_$/1bO)֒<+Ooj,a.{Mtc86^8^P)fItw vWyw?ìX//>KMÍ5}HsBQ²ewQUW(%k$ųw?Hxi d+Pt$3NŇdʴ&վpLia(HM_ VZB`O H&S˪Ϸ čmnMxɵ6[JɅ( x.}$[t~=-2m՛iۖTQJ~rcHR(G sc-bT@h<к'Ϊ.*&dHE O8r{ٺ/nR5jQnyيǝZ~hqfhp[eQJߎkG+ u'xڦHcc hP#y!,M1pCO4UqV[rX\F<5 ҿ4"kua)OJҬV+RtiǾ43)eG#I6,i'ԋeܕpߵVRpuqQ;UPYrigr6?jņ])j*;Dsy-#^[R +C~kbA[XR$*9қ GnbvF9 !<lG"9B2mPu4"Q7Oe;T$8`6u9[q֑M4f9Kadazn!hLiE&I4I)w尼^aM)ɞDBLV&jlK&mwDSFв݂]'BWju(WF$U6/SMhy,)gҢɝVJ=+8wRݝGR{ڛ(wrI;T iBuwh)N@F:c,17jb$rV=!ɫﭔ- nѥ"TED;Q|>/T>4TXڔ6{3pW("bj2Y{ <'z6]l9JNO5[tL V$. u-|<㖿VWu;w{!J) sz#s%ƵZRUDxKuQQKL n:VkƼMcƖ6;Ba_ x|ӭehJD@of|#@*3vvn|֎:~dX.'kGʞkK["qی;w/9)ml4xW>%^QXyZW绱H' (e| 8"#AQҞD㸱T7MGM+9Iv})aD6CȊM-ݼV񧬚v(ab=Nq im:f(4,CJPJ&9^ϱ$rӉު`;6@ no[NInpuVQ&Azelqvm'\(I㡊Z'wfvJCs;ЯY%~{ XsZ\e%0 ·1IRdz-4U$l4O<ֈ%I,>ʒ*;:&qÌ~ F!JU2w"7 b54!*RhF2TMr^ko*]Kzˆ؈U 9c8(1鍆E ܇$m_V_(ezU:<)\K*p:b9q*udqPcKa%&(ܺZZ[Y'u$ӷw,e\1 bյUKDR8M=Bݶ\K%FՑ,_kiE%J>UT-odZ!X3]).^Ddp>F<\}U = 53X*Mhj㘖3n2rG졗z 9]\Y.d t`=U-ؑ:0iE:a5,)&|1N۰轉*b-?aBĊ T"i/?~ F<$KmosWO[JHJDGޝ.`qJ߭!ex;x%i#cV!j%YVЦʒxOʫ΅*iIOݪ,=M飭_#vn/ZR#;$tpc兕: JIB7bqD7(J%;rMMV̉''Қ^jU0칇y`VI& mֱ=T|1c{ N stkoݰTwT'Jv&w1Y{pR{V߫&Fn1U7?.ر`jKDݽFuڂ#%iIbMбR(ύO6dV9hգ!$$ &Ai,?kR|N6ŕoSe͟Hwڴbk*i=~kh'mHq=(S":_띵IS~>ܖM/K |S ě2aK}IeW ) RF$9ɕJ2_[8Wf61֮snۧЀ{B  yo5qX%"Jݗa[/Nzcx^`MMھ<I*50 LI+EӆLzb۔wwm}ȧiv[1G8I/*cXe6fVL`)bv1*>V9hSm}M;{:/`zև璆 PQ 1:IT =Flխ(㷳Y:]>UX],י/ ( j~( =cޭ}nWmfkvAO 96&M <9|pO˚`]!VlIW?mS~zc tmDS0:zAO##]$=x];u^\.pGmWx&zюbYn7R[NP|t*qvHj:;ˑ$e|vNݎ*}xyk2lS>#apkMi''k$իt8  mMoJ2J0Dj$+4G)5R2F1RغrMnO!m!SRLB)O|67}KS*lVML )ͨ~"|=Dl]Dzv4-TΕ Z`=jkzuڀƻHP"zI;?R<> $3mpMPuQG(oiuҜ͋^cyMbf./m)UD 5Ũъ,ֱL߰3>fQh $O!#R4NBTR1Ǥ qICYMsG#`UuXZMJ5r#5$BU]CzDLp@.RBo('V&`ỷ*y81zSE)cp"꒙IZ[{XF#d K%[ax^/QPNr3Ƽ˛ϓW4heD_}s/Z)ܶ DRI [?Z_Ő08P(/&ZzgzR1{K[0rA}!p6IJ{+%ҊV9r'Wj OAQ,LOh8 A۽&NJCTbћt7p JvrzInWVݷ>NGtzO+BzvV_OPk)-%MZ"g6\[͐Zm0w#c1OІ3m(<ƼbgKM}]憀F |Wbj{2 M.}H~.b;.AP`?/3dz @ijn9^N.)mBUGbQ1{ xwu>YB:uQZvb،P?@aԇtU)z1C:)=붚[%2w'[&ۢeMM ~1J[@f}b ZjBTA; ZH*j% WM-!\mL%K؎\\{RPc p96;?Cghe6ԓTVbo%Wvu $uޖ29:;T+iCl5m4D܏b3ĊlcryIBv<;*.EqtqQ*:1e^dj Ttd\ %"u$㩓NEMVOfŒ'8rqI(@P&c՜ѵ+W}[6X"̔pE]t5V([&%:(7lRQ$ .^i:x)䨩8VKrML\Kmdשku8ƒFS:|*[\xl& v{K^"FrrE/ȸEү,iNhEUjՐ/[7j*M%oFI>즨4l^\`ιr::T L6D_Mw̶!YUe#iw(u nݱ,ݣKx'sC?=m^S S [i$GM">9ޛclNۑ7|1At^t#v4! A ygp ~<%윾w{] 8D?Ӕ$1+rAI3B`s dbPW9+.ߢ.!.ʄ$"ff\dA CPy<۴˷8liС^wvgW9d^bI*kC%>"EQdhWE(WA#qZ Run=| ,9JNIt|#j+.xؕ+ '/6r!pmm4%YNO젩մӒ ҹWܓ;++UmZXZTW)Iq`,HނMRՕ=:){|ؗgy{kt.TARHI'j+pd'EKd_'F߉\x0;vs#Py*AbLnUM4JuOm12E`/UaKvKpO*IkJM*^}^mv!MYyvm$ʒ,8:"Q 7*RuI+dow賮-^䀯Z!p>[zA%)`vȼQ$mZzWWVW$b bDj*\H!z"#K6'4M_؍^˖qA'QZR!~m\UӨF]: 6![4U;s8ik6eߕreMR*|9fؓ%D[ 0Oj a$'9IW cј.!4 ]Z! V'=QDZWMIz22zd)LVO2 KL [x6*ZΔ $K)Rr#G跉O}(֛YQ aq攴?e<,iěK FA/ Ti&j],gB&ߝڢAɬ>6i nJ)# 56&DVwo|+-GW81yˆ \8=YtkE<2d-p 5wxj2iӮh-ZBN9+1rN,o%%Jn(}Ok1ދs1qczxʋkI 96#zSO*bg0'rJ==@O8EIZsL-(s{-`έO'ZGieCō1M€]=T>R0p\'P@$pw1TϓDɫkl1`\H2ϿjQx[ !{~մRB ϵu+ɏ^>-l6\BHaځ/NI"V'AҘ;k օōj;rҰFAoqLQ<[bK2;Tzx]1"ܖNH\+ MA:bhusb t}T.,st%*wPT8[)@R¯@"cj"VsD/cw#z&q!%NM61r&{Shܾҥ}0$:Eyc-Y@$ۦ+v?J RVPJL%E$hcC=PS4z C8#?maNG<<$)à|x&1`vCJ(NOǴ?%``~ZPN282HlZ¦lu_08$|LJ0!6] $>tSz︟:bInB H;|G4B2mXlK2="Aq+bڮPPNo\q/Qb"-'VvBI3G&>pA"*&jJv bCJ5DAee'ۣ\hGCAz֎Y˭M>u=D;؊~LRAYͷ,`ݳixAds5/O}D ĔOAD䞁Gd2a&j%+jS? QR!ǰYV Dǫ8"qGjvIP|- K %%GJc=T9{6[!,1LA123wQ[ bx]H uHP܃1":X$w}Tl>hm#bqBGCiX;wBRcZxbê_ ЂJö)MȎhR7KvDU $q%>Ʀ㕺bbXHVˆHLIDTye:NB"#L "$ HQ[S@o&U 3 {9:qSOgeZP JTIO˜Y9gÜk{C+I $60DuSxpdXվ sٽ? R-nD 쮵}OHQ-RO 0[w=*ـR61ySxK0l-fA7 8V :]L: |;Ǜ7 qP"@y淑7)w'XI{mlcE&9jTa~B,\$ވɊ֕ެf=GK"hbЇ=w’ NX姂 ! v\Rd#}ǵ ur[U!$O#ޝӿQ-PTE(g/A wQvpb/.:Vv f¢7 b>@#n='pv)qdG0{ mUa)PA$F=.vW&KaP1\҈3v-pٔ/ Ug\=A; dhߝY/Bni+e@ᆖ>U,cnTwe+drq6$}Z;ĂCh BJ多Ըb=9] [i(Q榊"^{v\0H9ʕE 1?nȓ[첕H ~CxiZqa:ՕO͌Si{{}axjCŀ$̅ AACŢrN-Uk(\dD,:AVʺ@{Ys n 7j;:q%/r럓Puڤpi^vz(3|\K6Mͣi) -{ЩkQk{\)ƛ"8Sñg/YF’'B jˏ̆NׁcK&}b"(x9nP*85 M:Cyt.y?梔I- RKE+T!SF &M)Г2d!M0fⶄg]+1AN\$LԸe*)0RWB.,gݒwBqyRbz]"Y;.k┵J㞱Qu-{.#\j-U;Mټ툻S*̧P5i񓋤G]D, ڊs/[ IJ )W ?~,*b#đzON|1i^jˣl=X..P*5"B=*Q#P;mR'\n i ODde-BOXptV]E#Sa_>lHlDpšm@!; ({#%pHzI꽇#Ś޷Is$)&ƶ$ ӤS-" ̒xTw#BzU5,i#Rt}a]=/!@VPD?~jf{E @Fˆ0xO[C ?VX^ź'.(s 'JX &t]'O<:vzc46b:%\ooUF%kYݻ*URˍ( *3C~LrR5%mړv2 <Xí*6a wbcPȨ|KƒRSiFzfM-p_adVmJm񄶇YK[.8(V#RDz\z_ J\U%bfwCi)xRaO%()ؘ"(Cns~ժ[b,=#.{*yj(B%Fvp  SsqUғJBD?S --y>peiV6]* ]vxt|4+mޠh▷*y+8:X37[GȌݿA?Enh5s6 Z_6 #BKH's(KSuw,%WQx5apVkfO8IKD\G 0zo7!U|8tU. 5/Y6]ep=ֶ_|[&O+Aҹ9KK 8KY[.KC!A8m>X8'U=[&#.goo_+nKm >oMXwⓏc~LbO(>kXkbu*}G,J1W{߱7K~ZN^hߔ⋊ ۨBW%Լ4m*Wmᕛ-ڶeǿ6IyCK,Ru[Vk0>4Ez[6[+F@(!jr ^õG%ߖ۲*4̈́Ip0wOll[/A ЉYM|'t_=ԃ"evܯ̷+X5h=ee 9޽o+/$XV>oUٽ[WSDJ.g[񛀻OJ-<zۨ o+A9ݒ!d3ּi]tN,GCN}GVEpApDhLr{!f#U,N~,Joub/ PDNwL< Cz&zzPsa"9[|RͶ!h) go%Os.\S$DԚ^kB1sk? F#D 5,e{1}htcz Q7 H|hڡ{VɍR1Z*Բ'jU͐5{SjBAs(MqU%8Q* #˘TJ?1Cɧe #q .aN-!#H!{Аo4P&p=lvI$u{⹂8{m5L=O{p6+; τG)(5\X)*y $l~tJ\ / PLmQ8B&] N]Ck$);b&8r@m>fj|#HszFmЄI>*/iqۿIaZ3cwWW 2co'Vĉ6Jl7ۥ &c'}SUF|HGTc !奣3?z.6"BSqRHdR<\!h`1fV^ݥˮ]riI5wTm\(#y5|匛j CKKJNéй|*VcL,7njy%G^a2Jz.pI2&cZ}M ږHJ @Z"apJL(Eoqq$nJpdq)9:r@!͏,6'~""./W 4 `'Yޫɏ:-5wG-#}3uqD-[  X8zR*L,A .L)&BuꖨLU0;vݭ ־tGgΰGT]طn *v%r6Q;T='^1~K r;)<(f [@V~'S3~UE$D3$>.Q-8wSWE5L}#{gK;;нY%*J*bAҲ(%4[>^FJV?(<ݛ(zIzzY1'MfZęޤo~̙2#Z3CĖˇ܅q4gjJltk*+IuҖ''lG(-Ts&f" u$~vOy*DZHSj06Z]%E Kb#a۟i>y_*g/ w( U#L+K ;WgW$?oƨ!&%\3$丬 G6ՒKbI!I3یJs[ր$4sEa¥קqb%< ڣ DX CM &?F'޹&edfj @|Gnƶ7%AW4i]QEIuG#sIuQ,r!-mBٺoCN.LpWK6QZUJyҞU}(dR\PM ű,{wܥXSGWxqG  cYXWޝM$HQ3t}S_ZI(>0cyG4%H&f8ԟѡz Q }I3[\1ǍQ8/Nƭ0{UMt;7%nhҀu(~wyw#JlClֹPO\DjtmBlNJbL6M! }^Pcm΍1=1@j1ڥĚ#jį("ITnDE.d_RuơЙ4>55'9m grNT}L-}7Nd%HuJ+;|j~YWMD}֯}@ g)iKj.\ŭCspo Sst3Zjt}QV# ݝvTe)C&4C-%ZL&ľ .nŲ([>R.RW*o~ý=%tB$^$:⤩^`L|=Λqo0PQH!0cwO wȒR{g-V[(p~_Zwo.V}0]ʸ]>۝lT+ \t[m lHK`IsW,W9lo[ G_@ï3uۆcVUJ܉P 9Y5TNUe[.6.)`ìj2(H*@Ԟf\Km|qjSmEVWqXBͳD*zTIvZ%^\~;_/Ao]r֨.:a 6wm<irOKW q\Ze×0qC]՞hWnc͆RJDp giJrnmVlMeJtP( }{ NG4[ 6M8UwW?L:EwᒼGij9ba!) $ͬ4WN`ܣ7nۋܓZ[|]źovJץz? [.7Q2֔0|IXӠ6,TrF}2Nz%jo}$/r~ ssgC!&vR Qb\BZZNެ*oM]rNXOUh.=|p)2*P$ sFO}vUҊ'UQ*:.)fG\@lR]ibMˇJ]"6;ƙ(8)/bQY^K,|~g >)ҵn!p P|{(ںz쁥59sz R7"XȏISG~BU\a֯QHC;%3Icis.ܒqvxKqku4H !;U.UU=׬?xKG&fl̇j q (*)k4e&Ƒ1WAҶܻ`6 רiO* "Q& '\/C[^K`%92-vsEN!D(#;`L9^dȑ؛Vi!;?7c5K,/B[;4`Kn@ Oy+1786>a1 p?1M6j,H`},>w)o([s`()1 H(jV4dhg6E?dHz|-7̘EKcuI&N)S:w&X)f],yf$|{PVT3v.SJ)*OR5׸NZ,2ewrUx9Lެz-%1t^MbHB_,ʗ7-̢o$f{ol6qғ߭{.F8;t@xg%͵:O{wFU׷qty7zoRY($B`uKQqZ׊:0EOk3ط}ufP彶'Q-#m>V- ӵdНA|@ f{ .i ZT/nX>!_^7+ C8;r`留tsyU%ߋ:RX7a/.ymGBXzPϡ{";a y-zji.ݑbj 1I-݆\h6V}r,JZe ̕I?~'dMv֋a I\2i.!a{kڔ܇nl%`"DPյEtf$yx˅aZ ,*żFZr1[~ð ~pB(>G(w5g |Ξ3<)Y.R_ y4V&aC*v#̖lD')gx;8}:Aj=}>tj&0Im+yJm O*=j &`ps0侵yWځAStR* +VwR^1 [HօHʔA&xlLJ-Etp 'QQJtBݎ-1ЫCM+r3qa+dM^ q*2EKw )e;tKZCku*INv4F81thr[t1hf6 .rztz:P_HQIV.{|勼z5*BQ$WY֑BNtNM!|mhЯ%~‰3WuV9c_[o;i/aI5|0q< ɬA -!iYptZ; IJH'Rem?Im.~|˩)q7,n*iN!!!B6'l8i(gU-v8\oŏO<4vV $BS*ic}{RGe=PVw/6cffʒp%N4 `JDDI=j'CX{N嬿1|ŝ ŚucDž$Q9pyY/uWbNNJYx-۩[9Y: ܁D p%یyT݆fɜE+6p*Đ<Ũm(dzR7iTu$Vp,p\vՐ!JZ ==71[ |G\9wV|57̓)TLm5a@d߽ ǒۄ`r~\X)ڂΤ/KX"Lv9V2imWk}'opx{1=qkH|);JI)NJ_T/N~SnZNs/ޖA;:WxᇧN럠Zk[3rlRyQ;(K:M1Qtp{ͳ[7C-Kr_)%=U0,jNI5y4͵Lm6o5nJTu:vYMRJ}k{V))RcPԴ˅Pvm2M "BϨ_CyJsċ| tLyO:MlQƒZbz=F+ˌKhߩ*ɗ.G,}_*)>iy PQbfqV^9)K:jN4ͲPA#c Ͻ_wU9O}aݾAMų.%\*NyWݯ<90f Y{`Rw>e~ %Blno,̾柹EB}<_mz1k^^@m>dOzHg\x{wb޶(GJ%[q;I^y&0-ZXSC)P H1#"lQpV7V,Uv$]n.0:TyikO |*\6ͤ nPC>֤(:* + )BL*j#nT!8?wm$M(7{'-W8 BH<_B<%8;Ϊ (".{,5Hgr}mÞn핔8A&D~Frfo7e d^Z] 6jDn>T]pհvlqtn q p ܤ{A}YF!jv2%wG'J#IcK.۸;L¤DžHO23c.(Cs;Ub;V[hFݜwVPJz4U O,&$DQIIlB)BjT$]y+ ֠ j0'}fnS|C̸̣)A~]PjE[s~D|Q܏njT(!QKCw CvQ$N|145yQMdubT<0J^RmF#cPK"["QƀnEDJXEW0b:O=Z#~j(a7E+ޝ9*JZt 854-m5b]iJ; z6&) 9Yu8|Y8'傒YY8/诌xYg,`l6RRST8PKSW%m%Olm"O6q _JSE nmuANE'glmLPɩatϻN&=7nAv-hQCuz\2ͫ^\^!]5e)%wN) t&GΨxGI8^4ޚ+$5%_<')] Sxo7$Gҕ?ȣe!e\܇! TP1*QܿaU8R=䒨Dƻ;{R=rKk;4ڡRq Np؞z (}Pnvr^XjF =>}j T}Π8b35a- U8%[m%Rqv30MܺYW2ڭ Wi-vWM$J94B^^S^Zɚj܋c֧P3pAoNZܤ!h ҩ(8Z+ryʗxLl{ QON()ʈ_'7ҵB]2]^<A"qۼtVAߊX)*$ j!*r3ֈ#Lt $T+tR[Kʹp鎤јښl.[e8]I㟩+vFpלiNb;{Џ& l KI5;VKuE¦@v;W.[$Ds؞j)]v]ʷF@;3[z=cky~Ȟ4&iG ߊw(!2^5s;㹒6 T'Pt8hЮdV[–E,Xe76>z\wTH7M4iAȚϥݤaMfK^YZS? Maxbwl킔Y ɻbQ+[HԤ*9n2Kj1 R p_zIZEQ Ŭ[_+x1+IU%pi0cqV۳GC(׹?c"5\<ԡi^@:ҩܗH۸gU ~CezjHlY8R(^QW*5ή`sG{lº✝Ű_uГMh=Xޢ<0GgU$:;RPD86zjNUxO#DOZ|$cC!$TDwjTi^494iHHG 40-8mvޙBmxxb}]bQTP'~9c{38åĒ#H&ݵ)qG'dDަDr"tDM!KuFcx2v$rRddcRu~^bBOA€ +I LRcnE ?+{>dO%@5}ҳ>),r)8 /?վ?#wkpyv~RBn_m/!_q q!ʣޡ9RFMn1Z#œx{컆[Fv[ ;d(\f_ȱnMrAqy. auN9Bĸ ;&.`QY'M}ދCm-`;rnw8|ےЗ$Z:)!2O u9InJ>Kr/x^\BKiYQ;H¶]M<ߵHH+ {ȉV#R4R-)N'FuI^%x2k2Ӫb pOKGslRWH:`LHYi#Ǎ,s>kojN%G`8 V'xJH~s偭iwiz1z_G&o;Y e6JTP4((pMzO5m$uTC߈l7n&+QK`$?f8ZJM+pHoa2beч)-䥥Z›i7EVu>(or~z2|2 LݾHi6)6s=wi$\nv]-KPdLM\x)GKZHU{!􅸴nբXe+7+#d#j%Vojؙua|7iG՛a\;ʂOitI:za*:WŲʔ)6 bC}=j:%yҎCnmNXc,흿u =jP3Cj,Kfd#ll_n^<:Kuxb.=H؋xcw0YA%OCVzqm|<-" Ó|\2vՇ@Hyޯؖi}ѓeg*{*]9=O&*g{*("Xp乔\2XwUv^(=o'n-e9 cOӗV1|۱Rj7ND&~(ǩr{P BJQqܔ>GFK{v}طH0 eZnv߁Ù}vvώ{T88p+c23=>gvȻ"flzdiJcދ k{|ܲkOlpX'tmE'WHl ݲO7' 8av+)T% Ƭ= fǔ%i@KI=}ulBTCuGMz?|TK'ǤJEᇁx#zUx$O/+o)TRH-¦mܹ(B1fJ]wFHu(--ĩoןv1~L3 I L @]?䒾=`!e;ӊIC903-2[:ҔloABa'.骿BIE[*JPӉiui2ym> %1\[۫ R4ëOV>|n)o{.ͦ _-ӥ. jMHbLYo;i\(PҊϨl`vޮ:y6)kd3wgYb'LhufB98KNϒI.V,XCkاz.F ȫ8} C؋ۥ| RxNcQMG"x}z uMZp$2<.7J Jɸc2Ckg,3k;v hDE_M6퓨ЩvXr-9֢5[dvVejQHa68ܞ$}X}eGIrCUKĒeJL*HT=) X\*] IHпl>=CL3q,DDsI,IVTJD$L֭*!?1{=x=#uBֈ+_RHJM R8Ck_6"qĔi ^m]8۲TwX% HRF?JVS^npnqң\,!@*=Ouse'oհݛp,C/^^me% b=E7 ؔe|o0m(`J=j6䖩o]cr_-.Zۺ qQb谮 [anAvۥXO'Vv#-Y#V1eW"½lNؓ8ǐ;x'I3vɤV8GcQ:n\\-ĈOBI}I9$g֕NW>k^^uq@f/r9bkԭz*mn%+ UoY-.}ꎌO6n%%EE!'J#u5ƙ,k2HBpOS%\2V33v!!J'ɨrc. AؿqJ[í[`xxb0>峋\e&HRF}:M5%v$R <.ȸ x爮6Փ P8 ) o\UWLWWz.m qL@Ru(H EmzlQViu!Ò\ǍY rMӶW`5 (z~(5X(=ɽts}\xED!$-I:b:2hL%P'o˱_}V0QN?Q"KM7-%k*"luZtHh GGyN{bXM<90{ 8 gT-N !)"f6H>k-j}Izv 5qۻGxqn~m0HRt*I:$Dc6)dw [W{ yza^cٌMxӃcm!Ft\ 1Xc]N+Zd/p5A.y Ϗe[kl.FKW(hq)2$tP<)06ڧ-JU?uI'o.ܿݿ)E+^Vk:ibQMm'(N<`įFc\y.T-LPIb}69N[:ʛc\qź N֣Iݫa=>:2ordt`KL<⎦rH韸)F4*dga;^X_*ItۜCAWxٱ/ 0[a6'oI=)<)Iu=~[%^xs01j_)RO NjxW/r!,j.)KmP}dX%J-L}yj9hw)$nyrߔߋ*wȷ5˷u?UIuu'P2GC<ѝ?8GM$E,O \)2Zɫ'K@k!6OMѽ6 JxMIT_2X⟷pMͪ.4JۭM/SOp/jDzMi OP* OK`ٶWuQr8#cVtھčQݜqJzwq@#l5):SZ9HrjҒ[T{SZ`<5& ~U߲`@$A>ף+@qGڐd-o8W nj=HzS7TQ67PSM8QL12q+]6~iۡfcztP^8|vRL볚W[|)hK?TCHS[Zur$B|n峼SqaN)B7)Hg%W-*u1„ܼAEtNM!)v6D)_MLr9&nBcI[.ۻ_R;6 &Fj CRBD$@t#d ]R+fݥ؉Q|)RWHrlLMWvVsuhD iH*}A:B tOz)i&)YIaiTcӻ66&V]zV$ SRQ |5E)xe.GJd66?l޲&)XT) [=)G/ oH*KBv J)'Mws 1[ )АJRDsYd)uNNw6Z6 $Qo\J߫+rƞUl. ԶN'w@0iHޟ# Bwޢ)Boҥoa b(AH|SzG@VMopy 0MsV2ľTM8kjBLdKr~x>D{*X]4[Kw(NWD3"*7Kw$>ȲEip[5}"<'#bӪN"1VM>ϯv! R.ɪi^lr1 4-5h#mFWq5&91[m_#̍GPj珩W>bBJQ*<4 H-%dUiC#*MO)ݣ-$yAHr.89fWaju71}?OO .puцgy)mi(T)/I7mb[ɏ"W± ݝr1c3m\yIBj8N8&ޔvoFBK)0'fԨKI6Q2J6JAN'wiKJ#[av`vkuIyZ(̫4wM&ź_!%4B=UWWd' 2T08ldu7k@Ҏrj#ܝCk*Z3rSa (">5C[W[l.xүƆD޲c>`QoNUrG5 hu3DV9:=j: LLV%-BR@-[elP )GsUF=@V grjlj/ޥ+m@ c*u$ɛ Y#jM%[ z@׸jlǿoQu˶N񥄵Nw]Ƙ[7`Ӛ )lE7qarݜϸddICnII=SϦ߸ N/j HޡspI]P4p|%ƞt"YÚBfE:{N ;td9#B֨O|M>б I"r^M'ZDѵGLt+zrGgf^M)W"QڶY ؟z"RR!#P"쫷V`ԮDJ"vvO^GKU XTRئ G-EQŻסS=phpG}X,6BcIrz~-a+Ug8Io/,.t("vufx֨ՠ2o8?+XٸlIʐ aDت-Z n)SނJOp9!k~۩2y$lud N)s*hqoӀf qoD= YǠO'=RsC/`sr~ZL'H RdJuRx/2-BiT~nkXeU7]i'j@»<},R^;m=CXsꁰC+x <`h?y-8n_%{*K&[+<)\Uݽ]!"!@H :_h-zJoEF0k,֤ݻNO 7m6ZVZQ+ K2jVF\R .\Kmr۶kw gLˍau4umiBmLkQ?@ P29S|v[)F$8 QѨ$PT@؞65?Cé,zcuv~$_}_7?akߩXiKBd:+'Y/T]7;dyh<̘۲Y[XAWL$< tƛ{z]%1^d̯m}G[& FHO?(uUG-OI}ųd=l~x*`#ޤe"k3KB OAta?[mϫ]^g19y{ڽh.GV@ԓЍf輹)7-JJ'vbťX!E=Q\XgO Ռ aea|ZXv:= i,y"or]mz4\`x%w+-X2eByɜ⥒.N4V&!(Y<+_^-(V۪JRH5epJwMzXgoQL+f4%'HT:;R*i:,ao~HNeq|͞.o!N9h4><]+'Mc4[Bq*i.P iם)q`:-Me%JjZm P  G Z*FƹKo~˶%[StRju7P2JI+4mJbB({bՈcjqI1ɡd\^%xi{}.!jp('pA'_hkϏ˒^Mi QGrGPAdXiNHJ֋Oì>"ORxgFap[D0{(N*D@V3qd(Oi/R]W;y`~Vm@tK}"ؽ O~s>9 (b;iV4 =u+9K Ԟֆ L5 )!=VSIvC694V#h nΚr 'I1|gCj)O=P=>vFa>_5u?ˍkoIݭLu2"p{ WW/ց?VKGʛX?ae$ȩ4o[, R܎j[IײW^ԔuT%\RzBM#9lnC5NrL%%̎ZUgcfD},¿I]G3`p|D2cdz|)~,Y  )ȧ=Ij9("DQ$$(B K*%ă޹ Q$3fNDF]{B.Δ*} 8p*8-o 2 £̸|HNGvմn߶=V6b3fYPC تS{t㸬L~jSd[w)N"گ,u@bG`yB綶r- í ~t2B7NXI5[nwD?Xb-m5v㓱%fO#nO5 ÙbQ~Z[6x<ϤeC9:#eܦ߸3)'."6j~Md6$]j=_!Ú7bCFސvz 4D0_9q]t8R|>$TBy11( *5]̜gSӊ~i g]*vAM֥,pDK"$] h=(e\lbj*Q8! C_& \JCZSAzmQdLgxT'J}#RY l.2crS6C fHM:J1|C }Kv Gh'}WJMbdj%6'7ؐ %{LnoI+sC-4 &+Q+NO}7rK`}T WW8%TTsZM%i`wy-RA֣dЮr? %T.+H#^犗- Ig5[xem`y nL Q߉=v7)r'˗Vރ' 0;ZvJ OR],SX#;N`8kW S+s*ǎS{Frxf^ eKlbDG֬:΂SR];D<ǑjěfHkuIf|7.~SRj l]4`m1U- ĎݫS'iϹm4?mH-#s僴0(gXQ^vg)kB<PTc<|xOm˝ă>=(ԁܨUn%pBW\Gj=$r[kv#!cok}#~ͳϪ K-D):=8*qWW/. [QG}Ϲ/Kԭ C}=vgŵ3fuUОEQK4NK2˻|Ww8;al)iWUu⒵7n?c;ߟ ^yhkGJz{'BWcXn)j6;+P؃B={EgBQJ-\}sn#y ǒJȉUicbXr[vޭqEhIuR%DrjKaL)[ pCVEɖd:#,Wm|?XYu<=|dn>hB`el243]U*SsbLg[o;DuR^T6XP’ҩ:2ձ G% A=:[>R,#ِ9ﰇu˻e,(nm$(_ w]#RR'cEN wJ.6 W#vw/:*T(+P)"Yhڻ*oaj |uRJ;HxP[A?*. C 6XPP;hU9/m#t?:d9 @h䇌5VVh tE\p1EX#pv3bvSRO0D@8PڐJIN}n _we 5 'baphx4>gjd&vӤV9 XWlV zIhK?(5'6ӊz{Ƈ̮ڮn Q= 4I?id]>,4e(NҮUYqTrdz;QεDr L&I.2#1E(kBܶ >$m1;&qm B՝ !=:bܱI7ww[!t~eQVqW].mOzV%݆O}q 0 LIQN<>[og Cܣej r%J&>͑˭)vW-@r%.NJApFs~%ʹ)fk.ݺu5BJ]ZVЂI_n6ޗ?A<)MGmI_/Gȩ:W?b9'33c.<4 kcQ$PgOPk%+J <]{uW9cgZ gN7u;[zf,~!D۔wԛuk΋oS0yz-Y XAK8t;A~7iSv?^aR쵘 oq'biiK!M% '` &]c[h6vm_'N=W1\yul (ѻBKI d3|)Tv[{zJc.{?V+K7V뎬 (cqⓧr7a'?\xDŽWx3fbҬԕn $%1q"Rwck]f8[q]'ZoY"wWAwJ)ƂfKaDODuYB樻;nҿ ~Vu[Ǐ0,U^B\m)M-*/;MoKݯ5[{IҮ{xeL%wmrJVG$v+:~I\5h]:2p|:WcI$"*zn-7[zpMH3_,tnJ h7Ojt=.mE:l\9?̶7mv NVxa2\N>B^AxшqGm.(i6Gyֳ3L~vߤ}P쳜]Q.AӫH?t41GB<݅cȡS_-19izYWu1ER;YTw+\Y0տk%Qyi4[b\5U9ļː3Eip~THQ?҄ߵoAxmmy̼!xZ8Y"9L](lݏ=^W_y;ևÖRTBòEZA+.3m% Ip!JcNe֪u5!,}$'/e, Xm;ޛ/ ʤuVEK5_xZۏX#IpM[y+l9Jo] Hu4=@1#ފŅM^+ ݷ֊B :G8c_cQ:]rS-\Uo`*PYIFtf䟡sZCpv/Z "-w:þB.4T t}2).P͍[XC^_%T,m7#mrɔfi~Vcޭ{P9zFz]A=YAr[snJ$|oO&OS}ೱL ubp6zBۧƄ5JJtvJ i*0#քqqJSJ]WxY-$kJ=Lqqnh]7☘)L%\c!cuwuƜdmdjA;Uqyq4ӿBXgxI]<\>#b z ץ }_]QZQreC:դ?=2'gIp`dC.ؔ%3s-LiڇɟVD}OvyJ6 SI!E09(=d֟1t^>̮:jǜbX<ɼdZBO]NQ+}9f;dؑh{oBv:N˞]\ Q8(̴Lmڳ[Ռݩ Zؙ*GDT5GO$Y3م__ mQF8l,JqyshT)PJRL{C.w݈,+L iV㪒}^qN٭2cqA4q-*U J"{TJ- GgJ23S":8Z'i/$7A 2K!dCe4 jo3'h=ChhB)!EF=X63;Wï|bzWd#I3/0Cij' ?nKXZL& wnB RT *\\#.ԭ!jBm=IPNU"Ka)B8SdKf$[#d2ִoQC-:(^Nlڠ|? %+-`tw+q^K/ʐP pR,qXۉ$+;.IءSXQ sYJOn-zT4JfcH{M a^uFkH3SnxVm[:V$$ɑ%"  Oœk?CɘiU9ivkKed:Gq=B-#Gsv!3$Աn%K|O-ټ[ZCVNJɄ&:fX/+L e:Vߖ= ζ6xZvAbIS5lze7"#ڟ7ȉXޕz1""6Vۧr1d?r=a7# MҋxM6{:UI'H-M%[i\6)*Pʷd6͉HP[BATZa[w.Z ja?JVU# ֛RSqpM&YE˛[-Nۤ:iOP If+[,K'ΥImW620eV) c p3 㿉ײ5Lp%_HJAKV%dm!XҊm,0cI$/a5ZvJubqzHC~)st/.mUʁV9'_2G3`~f˫뫌&{55f)RdԒ:hOĩlھj2 tUY[1]ZQZeKh.eHd'V/Kv%uChۡb3ae%JbU շA)S[" (G|;33֍[dZ_!0+-5$ԩN%PA+/ x',\`zj5Gv g&ZCk'GVsWO}'ݨ_S-hN?gb_Rĉ1b5㰛f_´8;|*/,psj݅iV?1ҙ)PH߶߮ WWѓLoREvw KIDCn"^ bFŒD&f^&.򋸑[۫BY1kSI<2%akX_hLrk *bjhѼh^E6X,󕿇W0R3`X=qِl=n㱢? PveqtZռO*&끼˹wKO0U.n,oM,7gpTIj`QDkUҭ֦>z7YWh13=> >vТQ1n+(^1G&)j7-N9ҭ:iWp+?,!-Km>a@<F5tij ;r jQi2c' 5<<@u4-d8ӭjcB0RHPRF 2=F:زbL N|eK䋶Ti\HۊƿT*Uڹ[k^;sh[x i"*ƗٺkFNN֓*CWq.#4isB+p59T3d_Бb:ɒ{Ѫ; bXK$w'M aWL[~YJ~ʣF5z<qO}o=xokgwZPL)t /HNpMO^Y<%<@o![jx< XqNJ-{U ewGy=Iiw e8\*Uz~d_I'!x{JW*,mAB$'JD5ySmΜnWCC+eIrgT)lO9IU/RDV{w:պ}2 M;Rw6s*2}ejZS *Ym ._[ϩ*ҡvR_rDg:}mHF=s`iZ}6LIzwqd_릂TŒX\b qT~esYkR6d;;jJL62E}ʃiJ Hc5WwB؂t?-2:٩,?mMT[Ki(Ԙ;DnANw곻wM9\5QÃh)_2Yl]) \zG5`҆650K8¼Ҿ5qQ;ݾ_ K-T'؊+q腌Q B'ŶZ;!@ bKrF۷|GSPt=qWO'g1a7 V)2[|wд:Ժa[ATj'h1 ;Pӂd) ;X )BQnf)enIyZM[ntUښFJ6~sƝȴvǔG8Iȫ-QH:Ovv88]m0czTTuvI&KIG[w}'Wd;uqMt+tOKL<~ra[(#c _ڪH}˖pΥjkM}(ı;wТ`'۹{_o4fQmDuQ/p$/oPS \S+؂SЪ?qxK^ܭZNNIZi Q/u^2\|Jɸwe˥O\ RИ'tLgqڔTwwcT6{CZԳ3xy JyTA 9aN>rm6}j,2ӶKZFwPUgJ>,3u+@E:u#$j^\B\\25FI^xǚ2t@yT4~tR9X VA;ȍmS!V87K?y5 zz= dliq.7 "YSbFyh#0s FA篵vJKdrYRMR~NCjX q*bt9;rYߩHQXIjdRl۫-^EypAВ7Oſ雟DZ.1 8[` >9_A򕐒VzH:yЬ k 0;\Si[8UgB`%dI` Iczc$Ԗ|w@; vVe␕zI(&;.)@JJY qglZj(|$,BmO?)2NJMj;vߟBGx)Zԥ_$n4-mTz6[Aw*pLU3I=1omu~/;ۀ<&8qrzmԥ)+:S#W #TЙ|Z]F(FljwWZum㧈 UVC% &R:$N8<'óNZݿddka×n+K-R DL= oUX'ً&f[|BŲ[hP 1 mNA[ZMvp{M(>.CO2?I lkg 7x^8pI0wihHTUMC7J)Gvtlz[.lgc9m:*״Aգ𮆥W[F>gĶిmhnӨPxRO[ rr,4J$8&aڳm7+uIN;U`ɪ\z"d{{|.soI)Ca1U}_K ,jک/C'R3{k#68o N(\ 3%=*6u(}GM[އkc1w%m6AӶ7'WuTaնӭعk(< 36\^8XAP~PSe㞇rJ1svl%mqFx hqx[z*v G2v;aLf44xF=5sԶo2PmjIbv,HSf 4N?fӍqmq KTX1t9lJ@t M@kI=Gs4q&[}Kļy=y7c|BRΘ MI3#WI]^Yㄱ(ŽOԒm%<$of٥ye*Y&}5W6z'%_!f)?^6u?;e䫋l#+ΐe W>^?8}p{[}%^Y8UWrz m.l٘^w J+_]҄jI`շ:̯ю_Km^h㟁t޻rتEaVyMK }zWwڬ:c[Ъ6e%ihH+F sGU#V'VjZXhsᝏKq_ZMAaq_˞Yq%1ymƊƴB`*  ؏,R;ׂ:FV78 I=*(^xlnIH:|h9Z#.KL"DZzaEy &"zJU(J]FyJWo, M"ݓK'bgAr,v Sƌ+&䖞e#^$l L~V8:|iGѺ<gtg nG}*$I;{WGXҧ?S)S9TGjrX=Ssn16TcڄGIú-:9nrj,BGv>}D[߹G-fl"*' S%nOݧե*K %b>i}Y h *W*jxτ$ pdz.Q->ܭf JJåj IR\?7[M'f>=+䬔`)t؋6崹 utL,i-qJxwxIZPwWR,zM9Y WVieM**; nv7Ojw [P e;dG8K; K 8󾭩9C(*;4t\쟨cg*/濐@h4Exfe8ہ Zv%w,m4 ,Uq53mő"g9ga5tP`nc J 8Jh3am^,[bV\;х'J\GL=NFaf,zʀVH)؈ޅuW'CbθݍJ@ pVlcqL jJH}8?y Iv MْA=Y,,]QHN^Y#UvҞƛhGq?)LqPIQ6pT:e"As,dzpkan(?k3fi`72 mv6Gp(,c0@"aZ>~dmfos\[KIq֯aVE6br-9-HP=1I{kʏ".*4GU2a#Wv C*a7Ͳ}DrqK,19EukaZv'\F{{_/SϷnfTYA:|gZF)A.[.1mҥx@:WU.jFR]Rϸ^c 2`Y(emOII08PP3Q.~(GQuN.k[Û߂Y/7eTD'LZti*W2~؛XY lǘyVݶ)u>KΗд%ޥƵ\ 1[ljó 'IOcȩe&<3i\Ԣ`*{:u%yɕ4ҙ>i(ǵN6FrȕpmZ ($BE,rm[cmݹ)Jx}RNᴷ2^9'M<~ݞ!N1Inh*d!onD nA_1$ئԂ$pɾ6 |/]z :=jY(S:Z+QT}`0A㱿%EN5K-*rߩ]HuCVllhq“\Hdu@.?WL#ڟ(ȸsˊ }ns}Α"/>ۋBt@bËKWo$q!PX㝪P\E5*#7 S.E9!]yZ"),e l2;Nzlc^\ )qxvT7hEn1E2FH1TƇk[!/6W=>5 Sm6n/`n#Du,Pbdw#7Aǥ<S%_QG}f)p9l;JKPe.DcSNąOTZ~Mv-dee'I GJJ2qbᒓkTM ,잻!-j1zI.{0ɲ?[-%2Tb)w 7[1:x)x7d aJr0 j#ۈR@;o]t2lg &5O XT_⌼IR6e3QǧbP݆3qspHZOJsrn nb ں[kWS%N)nAX R蟲z;GZQzk&lkF'qJNn>t4rd>u'P.CcΜc6\n1a`QdG?AvX,{S A'Ji;Lk&C++;S L(f;W- o k!:.8Ws2뮡%@MiEn!CANkPf*&.cb~iIYjݵ8a3u4;zM"Qf hmL.ǖ+P;j>Y+/1~`C^u3;lIpUXG {Ev$65<Ö̶J\[ڻ?\kZuXQm8֓0tPW}uVLVòoI{.၃x$Sʸf/z [H:A$ȊOD[y&td,ozvnmB.Q㊶ zTҒrIE.v[h#U_ζC7䢶O0<;ijA*$_>sԒR7Az^OP<3 ™ìRv뎴JJPv@ԥ)x4Wero[- N=3ooHi i`xul8_펯t.=Fk觙\0JI|648:IQe'}p$_2,;pBBFJQm1|Izɾ,Xe_#’ÿmˍ^¶;ȜZ\NտbX?[ ])J]p58rO'z凗I#o*v[X8K1n%lZpm=*8Ϫ V6G%O|;񟮜b.PK)(Ki ҇=N*&f75/^4%v;[ ΎN}ٗ Kao\\Xذ,uFIuW}O(a'\.~j6oŊs2NfWCJ[SnN 6)շMK Qr]kO'I=R\mo K^nư[il9HZ?z;TwFOqG`y(2D tW$=,QIo1)2բ9QgxUm_t!4҃NtZ#ܩpIzL͕\p^ȫ C֯-IP H)3^tmIKz^!O#dL#.1/|+[YVR5r*H4*zogl:o92]Vum!fؗ:!+&j\[Uޠq|63)l|۲hҔ7HU'tkOTnHij%-*UWފFJ!FfxW1nQnط!go=^,q*RpGAQI<1ŶEY3я ,xr^#scum€ HR@騦c`UMN)5{kpLbL%JNğ1vק1m%ucMF/~kPIFXNdu1[l396Qa<,z S0 OTn}KR_/FI4RteLqwWh.yzI,ۅU0EWcuϗUƔiBt2)U+eŔQjcLx j|+v^ouCO4y)HQ<vԗ}y8ZN)EpY!Cz㉞Iq+C_|y7V#M`Y,@ļ6iIFO yV&gFc`XZH3􇷽Adz1~T[eGP v߯% iW؉ʋ-}]Z<@xQj620_0%I"`c"K;g+hscXcnm-,y3= mV#&Ƭh!j#IsҟEj؟`xv፭zԑ*#WIetqKԍCNLUrKE1 8ʖËLR hΗq٢6"9G+}V07&TUر-ĶyHIҕ$OjZ}F%Nytؒ&EXM@R@@gmZl&/o$߭OulǀxTIޮeQi-0̞k}w*BRP/\K(bEx9j:2 6Rv%(vToxl}V^A2AZZJnN<A^C?dM'Y>I"s?ګsjLU!-s0y_׶6~wT+C #,D,FpR_XG.R#Dt<,qR坻gSudQm/(vKRՏMc+`^(ӥdnӹ;nON'[$lo*lq'le IGbh1Wƕu{q[;ZZY#URzJRr3ǰ왝.nTDBYxSOEXAAmL_<3uItc%_kw.Дi'dyPc[%A|M7/|"X-_/[)?_!#IH0b7I2/VUr憇TϿJv8)OqGkcvP !@늕8Cp׵R- N]$ 0曑KMr[qp74Kn+e0OzN*ʽiy$>7LfٕRe-߰Y|["eyڌ蕿-W)NvKu{QOa ss--A-n7QIժR/dfqKf^įݺ(K!w-BR ڝ(%=ϸ$e7+IU đmUI<(gN"+Sȵ3dqpU!uVW#i~{36 E_ydĄD񞕣:eN%m20+ˮ3 pO]X|bg-6)HX3O,S)Y%q ۗ*#\rQ{5np-rvTL Xn ?ʔDrBjienS2$ѓN=0@k)*{ieJǼ(.[9l#w}Sƥm?hT9$Xpd xf~d٦ o Eۗ}|-Z)$1O1V;U[߯Л\4o?. "AӳX<)}߬{Smn$BYX_EhyJ!iCe^I/k%KaEеvjtp5ۻĬj>߲f[F%D*tnpP o%{ŌYm,IcЫl- „I@ۈ76 $L 1#-֐wkK{߱IPd'DۍJzMG'[ H==az%=%V5ΉiR-K;OYPgW;(I@x bOsɢSrC6xvM..zN9,PJn+cݵ04<̦7I^sy06F "iD)CIi@I !r_VD"WU}3htң%nqJ~:w54`~ie*I)\{T+<]lRx W‰YTChCSm4H5ᨵS>ƯS\QP*F-ݜU\yέ.(sJqgp Cy'ޤ!&7g!>".w"n@uLT+jHYO\oQN6d؁+V>?Ֆ(fTʚiWmrINmҬ3{ z8QZJecpJv eŖ#X"}y{7)`x(xRZhT<&8]"kCyYҟKTci>)kn2tn<5}f97{߰>fYٲv-0ғ_I+RA5u-$U*ծFQ>ۊ. Ƙz|KI `^XK(cD\S %q{"K -amrWaQnu7c[ۡBl7OHܕ&U&; 7+_Y8744\ZP7$7LD!^%I/̉⿈0H]!Cmap^ WXTOA2˴nR~&nM6 $~!b^֗aL-**j |cMֽ֞_/n!{{'-V8{ ?Wn[XVI wVG8!x%q{S~'gf]5ԋ\`\%[4I%Im#mO—£'rÿ9dbٶ҇JZ8RZTL^k)x[Qv[{q'/_ # noҦԖn)Pd'cY:'gt$R~$ÊKd^ y@&AH$V"AUs]?W cojYKyۉh%+W8h\6g]ꕫvC`vO^E²il6kK[ hPjJ&Idݹ4~> ̋OoE oK[,e|"`7VI6ivinkx\& f/1 en)=:W1ZZri7K_9 Ŗ-YM*Jt%(I(7Ƶ c\iOPtnT~*]\޹i>JPeOaf? )N*{xRRM>]~mQBU&wߎE,&Z}<%x4;^VհX+ő3ǚm4&H?tc6JInN{t6`7XhxI) »j¥/x]WaWe㹃!Ltڟԭ _ڃs]xIdqa(:{ٴJ\WX!ۭ.ۍ-#\4PH^ޤʻ xҽKdR/|[yȷ8VV7%A#[~`|@ո oy[pF ?9K28q;UKqn 6u( н\z1?^/XakIE975qXbYVѥ.,zRLgV>%t^W*wL㍭iZ/bxCWL$m)wIHsWԓӦ7~;BP[nf`عMQl VOzL]>D=63~owx_oיW?mhnlId#W'**d'?Djw6̞C_cgɋ f:K>(i-@0[1lZ[pߠn7ܵ޿PmwI-1>ZZtN咩Sa9mӹYqU͍U1_q/3mP*TB">y\+N4YGGh.Z,]K~c:ɋƬӘ1U-o|7=}X"s5^9'}LBS$}Ey{%o1i~pF#sۭY<ܣ;-o3 fO!p.Km'iHsP溶lzu&Gzsk m̥Qn8mѫu\[XZ~%G4jM-n #cT6%efI/)겎X^K$W*FRW%ܺ90姌xݖ,E˚Squ'#T*kO27O5_oAg3؆-e!![~ldȐ{op!(7.Y[=fŦŅF%?hP$HXtS>_,ae}J9ut9ےԣWck [FC9>y14QJK;iQ_0Tm#I#Q0j7 FJqMt Qy-*;ޓ+շv,U>c&[g).;]AR@>ÕdUA./b!rUmI/mG_ Ve``?lDy=j<"4B!2:Ng{up)hKIHHq̒5Vcu rS\)$qlE3dzu_!\= [O+."ıg0;뤰 m 9]:!qV9hN OOT?fޢbIu#դ${*עO-0w1L>+Z#袢Op9cد3.`yU+B m]/BVlCs2UdԞAU}.8zz `Q۟~Ru<_ĶP I! O4v>Z, ṄfWsv`*LLv~MP~(?6)KjH~PrG'e}ct RmƧvq 2St6ucd& )6yr Nd9W*MF%+xm|W!'+ajdE-<DQ1𑬥'a1޳F%q'Cie*ރӸٷ 8,\VBL&Fa7NJr :`}q,,y;Oڒ>+e15{7L:Pjysq[^R&^!xa4>ڭ #zAޯA\UjĜ!nBF2U|1'ͷEa 7x>$ٱZ.?x-WԞiTN7V|J"Y-4DcNo]lY1ɋI;Nlm6x۪R`@>.I?I=VH8m - /VAe۶^:AHoz|C˔e5Pm3&^Xdl)aXXJ3%G(iqdž+mjRmLXƈ*K4ΐՄ$4I.J.nFpց&d7>[%XwXn[rm>AR{(|pґıӲM O/}b20W۷hK kZǹ~zgz:ou hnml>xϘXAh;r*fk :PjN(|I*/o x@3(&^[ti;zn+qqu1%k\ J]]-2voE, #rNDxv?}^a.Z,A+Dۥ"Yby:‹ eJO'VF9MoےF m\A@HHOB頾)?yθx: liT~i6(3>)g =V\'\^5;dWT'cPe&U̻d#};Zom8v.?:I1Ԅ!v) jTޑ;% (HէI M(G|NNF, .ǵ!e)@D,ɒ?]=Di$)R%:.+'Zbx9r 0Q+&Džo\?_ae1#e%DqMzu%]rC΍W˱ob> ㉵le IЇ +DW?X)I|qY䪦ޥ!bp wӲ M˗X)IP@_@S۴|+_^9Sej⾤p|7+Ђ/M+qԕ)56rq{[[hhS ?:j)#%og_qӫuŏl^eCm$>GDPi%~ė쩱DW1΋?qDO鈾@ :oz$Z$LIl+acNã#RBR VIJm\juղR9 8EI7LVw.Ѕn_XJIZ]aDLǫ)`! I'f,~^ G*AI;(ULl|Mw";)aGcxc-{ J][kZJS7$ {VB\k~)F=K;0E$r=[NeJtH')O1|yZ~oVUå$;޾||^)u= M1bWhU$xRĥIJjIڎ3J's#DVxp 8|2dǽD(%u{vn-ƬnPVO4{)V!f6}j.BU{"lk[qrќ[*4Q==Z\!Il>EݱKj$Πz(?6F(7\`ghTt56Xv{˗ Z ƚRqer6>:օ$G;B*$\ Pu ֖ʊnr ڦm@k\2O$53{QVLz5gF[P5{S;cNjr@T;%CJ=Ig.݆Lq4 :p,ߨ(Y`MM?T5J\rxžtʖJ4F8(*\.'hDM=9XxY_"GEh^E<qKn˅ۻ2RP wSrSs룭ײfߞ\_k+A ڶژmV?祻r?6ҖNH8tۻT'{3]BW<{dbŋH^ g{p"ٰT@=6$TԢI-G+ߵ,k]SkSdSs(\~ jߧ" =myac曏5Ni΂:bw'UI^jM6=XNbΥYŢ}K iJʺ7?%V5r}o=hdHzBNqפoOS GvWWZԿ r3(k|~PnEe찐w'k:wU_[|MN*_= TdR´O$lcjPܒ.[$y'|gcw V|_ab5iR!}4$ ,|]QFEҩj [vC,㸇tl+&NcTI;j_"l7z%Zi{vw!m^ecVKQKjBBa&}A[Ƴז{dPk?_5=S޻4+xL- `%*l ~4N6qrmzo-%NjkoNw^p5 lV,VHQlz{UKɍ~ObȤ~tJ_ǡQ{1evyN+PSjSzt^{۫NI6/C'OP1~Qn`1p֥Oh.I I$I-;O,p½<z;^T,%*;H=}7eJ ?66/6m4xOZnսDJ}*+Q;n KRqBS#QvGu'9dK!7=m~L:FRSeb4wz&7rUCpM S7wcwVζдV,bj[UU~◬zl7*i6~;pnwy@mHF_'tdΞ8'2RWA`2UVWo^ -ƛ,n4%:AĔ#ÒY.Iv Iu8=vةs9:d7UPRu# 5> ],bTޝ0z:ޚ}<$߂Z^n{Jşy)l\ҎuP\mIv} |SSfk -huR%KA25ss°ǦKM1cY}:ɦ2R|㿈6&8Ͷʌ6&w۪WЖ9ZTLωW 1=:n^_5|Ws83lq[Lm7Zbc*׮c(ۧO҇9 :nbQ> ~HO<"4=(\0Qح\Z$*"M[jUV 9h{+n&g4زsRe樎167xEAa)ACWt19_m ) M16XE6t14U<>U$xoztnn]~S`n& vҍIoq[[ ;Nښ:PDJF棜rIIHPU XHiZg BOWQ-OW6k#P$;sHq-ʈB ?U w!`}V%JI=}Q41Z!t$'SQҐtDqP-ILz[^u/s/W@;=]2dzW~TRZ'ԩn>~WaW6N9r ;۽ 4Ɨ~HuoĬJuĝ ;OSpCKD#~xjTH<)l% cXVo.F52`zoZpܓ[~/}!osM,PJu$<}곦܇䞠' 1tm:0:6&oF. U)ԔP$DtH6ayƱ/_Pث;|\d,qz$*68(6ʸ,%ʂLWc͗hRJwӧDksz9-#(-dԍ1DnS,EnžW񧮟tLY[o\: zU~bm%xyr5pڇeQ34, kC{e[%G\ $ #IߩǩPJ7ڝZ;C/ͣIpx'UrϢM%(Kԙ`ů-Au{$ {դr)^o\=n|Ŭ5n XS柒iZ\cƩq3}[y맒Vtl)3n&k*Tn78SVc˧'3.mFbBU/V0NJ;M1W'l!fS=T擷Hm%6- X))"OJnOտs?Mbn%hr؂B3OPDhO'FV-:)SVEr=niiE-$ _ڴ>&L)45{1B|{Ι,^mi 4Q?h9'aқ SpUi+oq7bsk iǑ²GQޫ';m=հ8;VghYIvZAD𘝨<%*s{Siwɓ i.PCjsEaMdmiTzE SMOV!{<lm:\TLH=H[=:V껎QkxEm O aIn/R"ϛ_ "y"Xf'<ĀԘus7O>:{eꦱ铿R9:2ޭfHH٤jvvk i~{".Kb]>> pEyAnA(Tߨf/6&} RkrI ߽h<;E~ekRamߋ)-O;@GS]@1B([uI=ۈ<œs}5]%NJZ[ hBjgP\vcc(ڷ?[ėv ЂAIjæNdm%^nV3M/,4Te#cC唲IqWk|EږQȁ$Y=%6^;λz&J=,jpP.OQS-b=6&hl KTHJܓ;KO=5uy2L9|*yd mROkq=6KJҠ;rUKK+ە $I{ Ob`-.5'zl8B 5WIvT.m2e^LdP:MC4!2[ H;oڒ;fkPC`W&~>OJ:<-`֝zqOթ{݈n/HudRDO,iptHby3k)g\<M&4P߬2v*&b$z8ZRf!"OHSG J`iKJdĨ̄ܓղvfX}]0aEI>'q]jzEO;'I\'bBM 8j##kdMH<Q='cAT46%2%ꐒspdAQ9].oa@4OS1Q^[[]8Lt䴾s1W z4H64*,xWz3(dY@+Q V#,E5эl5a BƀA9$);$py C2H"n mrhrm֛NLɃSVnARF~Ǝ}mr%䬕VH]j|hAYʭ7:woֶN)ۂ[ҖtI =z799jEVww#o2aݻVKuՏͼۅ%АdЎ茸jT*?W-k,3 2b )$8SL;I#*옱O̜odv?a?W,_fl3rd/u& ZjuGJI}mUm$)嬅ݴ,4Klz h<0EW,<եi&{I}*+t_,)RJ]OДTFQ3gOI+z[=;&˘gpһj=Zʁ'~]Uj.wئq,c-m^B?6 Gp>aU~T5JNV~á=OpriXۺ[ƼlŠ+H @28,:ͯT7R 10 ų%@gz~r&CEէ$/'?C b W E!A)nuDL={TϭR:Zopid{xE5P›}$`fTR(r${eCWU[j:9ԮoTI瀞m߱ Ʊۛ]iHj #H%%s?LQZtUqWޤY1ySZvK}]z˗4165C`1:^(p_v_ǂU[^_[c):o1PprBu!j@IDtd$^xgY)&\/b-[e\gn.,<$4ROP;ɫ'ӫ޻MҜJKVy3HwU[/ghOR#~ᵂ3MZ(qR-֝)Efc K.jT9WׁY06ij~8N/3xmIYZP;HM'eN;MJVei6VձQ`^;_y^ݵm^B *LQ$Eo:Uj(OnE؞dS[Wuqk8xiZb ]B@PT5>(vx}}.'O&imĒR]u}'ٲmMLG̕,!NalJG Nৈ0wz\e J5؝|i[w+_|:NW.eu\J*mM6mj|?YbdWi&(y>ʍc]!_N$:T#yzi]O^I,9q۫o_Ϲdgmb5kQO6j 2k6\-&n.=Y/SNRj 0Mw h/ SZԅ(BV#;t.<ȶRu;+SUVPE-dd & mh{+NR|n tNfwZpAB-HIj?#qZɇyF'}ѐJp%"LQ_:m-5 qZl.:S>rt]^X\۸Ļe;&/m""y5_'+U%r۬@f!هJ&(ŞsÜJ:?ptK~!qgLF8:N]~=#}zdei>/>jB,kӧ{4x($eg|$tڰCؔ-0nt7Ll2(Ώ).iwC3r#}q3C-&:ۓB ǙJmdaY{k AV`{tCN:nL`Ӥ^5Y`X?6JWlC)ұ삞q@aMGrS*eUR-𕤘#s]Uvη#1<˪uK*Z$Z|c>% EdH.|+^}OZx-"ZBҡȁ%LB'pǮ#1͓kr%eۤWU36L/.lOJ}NeS[?BԭR v^GVkRurNbxHY6yo`-(/2i:I֯Se`5%[+Zos?oANIOFi5%tXGɂ A7؋c aCkJ9\ m2(F c.l=O(rrðp[92XG].eLs/ l?XP M3\j6wٽqmN $( I,)<ƢԸ fE{_oϽI؁onI^`m IU˦R>5zOoo Ʊ {Dk=~U5hK#݅nջ,9tw~{[u._"I㘖5Dum5ok"՝4O06v/W%zqrgj ┫І1gk[]1%֊<$*GϽMOU- RqT^( MLv5%(}Y[o,ݷ["i!*vUM2*E*QSho68ZgvǤO z9V:q|nD];Eqosclɵ[ܽOiqJORKL{zlCx |vKF?ܻArD#Oz⴪kӻ)aP|MVCŮC6 ;J1ܟRffH1 :7rOJ_ .v+4+\854D0mmMnFQxRHB4'UR^sKEUqaW6 Qyk mzx_Ω=R쬇jUycSG"]ݣغed 'oI6X`n2E1u'Xңryd{PC >rB'5H玟bN5u7Mz(] N#sDݺ\q!G;nq<Q:D>4I|=b>ミ(BnyXͥCpwOH!cJ;*QPir 5ɱem<uKVQ;D%R|*!-&9%Gz\{Cr Oې;v*YstsXlGNUDj< xUת2 p#y6DW9 BKI%T0(iGI[{H .oЂtHg% v& tnW8d _$d 4*'ΘE6b䭭k#vڐ';mF6BJZ`ބ@%\MO-I '67ډRږ gYҖIAI3RE⫅iY"EZI+H jTŸ)׶y~ѥ܂ߡ*zt\܆uv^%-(n#V J-θUn411;԰u[(!JRDO_LjX:yu{P[F?ITy<ܗ*_`m;٩͡Cֶhew %N$= 5׉^bF< |2Ӊ&6uF**Vƛy5],Ib2]Cd6"UH*VDj"$'v\YU]N|Y%)$m[ԟ)3floo)炅!bv*m"GʕE]mIXJ/)R-"]lsE*fODzVY7qz@ (FZod=):{8|2 #gf#R 'U~+U6 VaN\D7OXty(߂ XTd;%wdbUKZIp]@ $O<-̋pz_&l%msc^7_*S˸eNu%QԙGN|-:K} l f[_³.3n_'"੦K%%[(mDFz_%ew}V'2mlqлχUt:z\Q$F⪥_IKV+*KeO cw%Zh |y :Yc|4Sw7QmV(Cf3_bld'6{IoduKgFI N\SŶ|uުB- :\ᚰLUX{`)А`3U󦭏մoBmۼ l&a`%fmi_IJ4,7f;男II;RD.hIZyQr~'z|Xjm>&Uk(;쾌8-/?@W_Y{~Vg)ݲK>ra9=6qĕ wj8:F)Y;xg|1wܖ"f=n6r{ܣ/НWuc"[mĄr7 \ýp $sVqnjcji'4myv!; ,q#zwH CJD 9ہѻ j)jUD2-2"t_kڠɾxSd˸ʾXӶ蒹mЀ(-Hx.IBG4]BSԀd+ҝb֌*R]Bص+#8eE˖*P5!6wi0AOꬢ,zWsK] >6o_V)XH $SZ'Q$ u E1TsTvzڹg'R<48PS=6gjK x8j>TqڐQvCRO_?ŃvB'I T$#54ZkF[#p ;*R8tDgK$'⩡R(aхv#P fj/Nnɞ5.1 qJIBa>{ToCowM/.[}>%).۩& Lިe_NCL͒S<#71m崈JhHQvRNY9;lW" ,1w "7ϡ-x%?x>^P*OSUGWoN-%[O|b-. W" Sҕt9'96KyuGU/_q3cX?q:=O808 VO xT"v޿P]$:yd{vn^faΎZovE㪗T'JK|j;`erd@To| ДQt@ݬmJXhnIӹ4X`^ҭĹ~mFHHX:߆AmȓhPM6YTJ[?(\,<8=@(HK{!vؖb8q–gRڈPMPl"^H6zqҦMˎZ]4&O/M*D%-;VdbI*VM*tI4d ɸ) XMF%o( ,-+{Jx];(g+$NƋl9_QW)G*]akhpUOefb{`Ѕ9* T 7OId[.f")CsreЪ.P⒃#?[a@Tm2g),nE) ^]Yk %JQ;Z#?Jui_Rs mT8JU#qE_#o,]$2[*W*iJWC'j>[av:{^jLf6/@j u=IvWG%W+Q8uk$ɈA'ɣZ!s]\}rBXneV$Gb7wY|8&~M/X<e.\ vOnՒ]#}^czo#*+sH#BźvڹD*Vy9!RV= ;":vJ. ^,.@P ښE+z! [޴gJV*;1I$ۺZ4^ :a =paUw93w[.{:X} 󕽡p((yO$(kѺp?A_dI\ۄV 35C2[)q9%2G Az3L~\={?|%ܠLp1X,qukgӡ\ YNi+cTPNrSTRmn*/wo`0IkVBAo+7~[7 ^˦೺Ž64 HH"xp%$mUϽ~+{pbk̺+qKm! h&'H*T4V87Mmn$J2Jt1`^Y"6Zժ[CzOR'a T6:a۰o[3s{kQ?05y*0aҞ~긓O2ZSQT[L ] r UoMJ9ڧ\[JIKl58z! q%(0:IZ)W{Z=*iq"lmq|YFݫ_7,6 L 4D4>L^~q1پf ȶP@Upڔ !"9HNz+V<$kz& ֗x{eęw R\y!.!>s}J:i.,QrXJ2t5j}mgٚn?7%S > -¤Z:c) N>Lr/175I5۵{{ > \ɷ^!xM}Nj䰵y֫QJI`AIR=12]"f1,[yۆnjJЁ i#bU*Ȯ_ˮOQ{M.-s53;ZApnJB&P8|F9Ek$[I%is=6Xǰ&b^`65D PQ2 jo}52Y˶x/ԑo%w.7,6I>Z^G\x'$гxZK9ʘw/1lyr仉ppnHI(HG<$Ti/*]ҫڟb Ngzsihe(}·K J;Dɢ޶t$\iIl>~e-z.0ö6Utgh>*Jf>jo>x !f\[8R@SEzS;E5Tuy4Kڸ}vQpZI BLpum o~K W7*IIWHЧn\Px,rWtGqqNEUXl ̨k*Qֻ IoxwIR^Ǭhs=8= r);$+6HbNOew,qѻiq. LC~͌C C*vE*Q6 Tm'u3A$NôVY8,C_[3jil[HBd!>݂cOt­_pl66؁1ġIqյRRDޭWjI{?IME\6{ўŚ6 :/ЦۼS:4JrN:ƖVJ_,\qokUz/ yB&Tۃ|GNBJj [bDs~󅧙r+HI >5)ݽU]&ӧQGgM)d8K{^s]ҷivM)SG B9W8~]CIuT rFcd~iW7.=I:NGML$^2em2Y`W6}4[i*uJЃUӋ[_iv]s_q6e yXlԔ+yedxQsZT]9uEW6I-KİP[Q (S[|Dިg6ߣ74#uI=T5}TyyW^Q!V {&}Y2Z{|;o+S9ƥ+UA\t^O!fF&W~.d*bR٤q Dk#`~(fzlA6w/; #>_xz)j}Y5gxXeHJ*"+(FMtf 7K+מٹj܀8Tp(!)I9nlo7[ WePL~)X﵊6bdX$u YCJoش躬6IeƵ|?kHK;_x0`ۻV\$;H(7NN 9?8][Z$t HR\Ii9b/N S.ebθ-rZ 7RJ\2&R0pjjG&/LC\k2oN#ߚC )߂\T1U?(DzW Pv~MPuBiH+XWNfՆ&ţ9Q6`6.bCT%AF@OkTF]*dW؂BvV] %&IcR:#OTRk됍ɦ$3,Z9&Ŝ5[WKCM|:<S#7@冟:M& v R;TiQos/X[" uʋXOv@kq*H $ʜy;Y5!U'liL\!u bxg uJK}$"c}x1@):24k^fԫVRNWDw1 &4>[O @k[M E'ۿ;b#츠:gx3&5ZuPXjMZbi )ī֘}^0Jet#J2&?U,r5^2,jWBy5pi"[i6\;+ؓUyz}veiKHl̸)S:A#_9,}3u>zx/Y/IՍUE I* ۲W:&;GJ?厜$689S Rdw=B1y&[*]%#L4"I)F"qT)m^ovfDz@j.r$F:ۆ[ݻlnč>U?ۆv,:R򂓰=뼙--1_^ěyzΙI᳆=-m^x~tN<-4_\U.8WAPs3>] [zMiUO+WxO]n $ΓЖY#ﰚvRJ|rJkO)~{FFjS}۔r^þ{).NȴWͳ)jx;ҵK$Cc,o闃'O-up&* UB\mW [i*J:;48;p7w ϵ1|\n^jGNIj>RrHa &''ѩ+Dl燇犒ILr­'x*|N2II=x.i})ɵKNi\!{mh*eKD$+  $Sjϕ>TF[Zd$~9upWp=eb`6` y~&EWR9 ^uiDuXJj^:?]ְzS"JJRm'=$qK?TB ?#j'{l!S$tɚkjEӒPQϊz+Yԏ@OC:͊ZU(vǎL&$K2@"qY.wOdWnL角T'gaEtbUt{YtF7"ɶKrU(aEKpom)&bj=A8U7K-dgy%Ϋ[-%#@܍]R#-X!h=}ǿj94s ;i $e*Դrp646XFR׽ׯˆ:D[`,IIS OYaSrمDn }XɫC1Q61zmm7b) o@eO' MÄҡoyUSAU.T9Vy4'Ӽ;tR#P?<ʬ[ J|9԰|/2Qῼr[ ෍A%.FhWe5m}L{YL?KL8WlUs>]jN?Y}?aLp }:ԔCbAwL&־_.)Zh\"zq5O1]S%vJ RaؾI jٕ NhyxneO&]L>_8}!5/C 2̨ B w感Cshkk$)>N+( &G #I~/(bo']ͪQL[3B*7}'ٯ˿/Wol~0wƞMpD/ {G) XJ?kH=>1N~{}M+}fA{26* ߪoodOOde,)(bDCPH#F,.7sOxT6î@IO$1;DaTo_؉t+~VK1^f.\~D%JBX$(o\t8ӻKg/ [!éuZ VPAR}xz;WIdp_S+3;=ݪpV֖q A;ki%8iR-o~w6\JNqd{m0/RLCA:xcǕ\+(exmpRr7oS$ (J):NQ AFPw(kh sv goMܽd>t84SGR؉K_%[];yz[m7q7g'asW/*[%: #Ԥ$rA$MXe7/ԓ\]+ﲤk(/qKKoj{8F JCKQ - W|<~9d RXx%*RL ) TҴ֗!'q|I~!?x=-,iLv]JF>rօƕN9ڡXO`L|kut1mSp*Zq)$)+-#hެe$z8ĒO8)yҴ΃ژދŻjۇu-? Ahܡ:T]d;)=PWMRMwF'n2w߄Qo'fl[F%"8Uk.Jq!EJRD qDt|-QQ' R{v+=( aҝhJ v8D)wk?etK9|EochJ5z\RӤ'O*P~sENzc7imay~IJ`XXo<^lփ5@ @27K%^~xx{ϲڷv #FX1wz4ٔ%H ld\j I$sF`{kwn>x2k5:3`y ,al!%Qʀ߭e|K:pޗWKBV5|>msM[Q!Cm\T;UD2K"2SR޸C<ɌdunYRԐu#O}؄ڟw*zt^3K)<$3v/֫WT~’7-܀N8plq]WksIMaG$~\jJSܴC^~m-֠PvcMK#-,@^Co;ϭm$Xه{]IP%@L|,w}V)&~* >o0}jN4e}zs=#'Hz|D%g_!NClnSf!@n;jh(C*eoq0Vx RU*7Vclyf6EtUN \c$ək+f!>X?Ozl:,I=W7G_7S"#jF-I#C+A>Ut:+K@l5vrYݵMյ-yJ *l.x /J{.uOf Y(<]ZuOXT_2QY2t8eI n>"Ud>e_[T ,gjM!Y Ru.>̍SQ;UQ]*[H}3]$VrxWw)}()a$a;\l(]a՛HiOj+ &"WxYHQmAͷWoܭdM-i ӑB\6B@$ʀ!ڎ4cBjk2ow⺒۶fmY `udjGhq [ WJͧicζ-  h,uaP]8d>|Zph "wLݫv"j뵄fYoڰ{gO#iiKw~ٲʃo3bo)MhhPHCjlqd[%c1 vխBWٝ#~ <kdK )ϩ$ ߵw-+ᢻǵ:m'֗]~A` vʀZf^Pb2Q9mĸik43n2Cqì,(%@ʌub?X<&߿2]HCfJTc`9P[OA⋜?֍صCoxzJ./HS#j-lV%!15TtI6ԑpv ߧI l!7鉹gf)A#vDS5onE\T&Oz><t?vwU=6.A*-YK BTi=V?0ޠjQt^CieZ,ܯY9tJΑgy>\iE.O-k.~! $ODjKZ=[_zٷ!T'MBjIjwn3Y:v JUnMKG{k-I$tnY9)k8?zӧNZĝ,PA+#%&gM W6}{]2 { [|S&bmJq:› .,wҐJM#߹PIM61e*g(2vI Vޣ `` J>S^ƨ)i:Y\?n;OqNMh7>K) n6ޠkS#ixbi'P&r85Aޘi`0\0[wI31EAw9qKN,K HL6iUED:Wd5j"jԚ* JU Q@? TBum(+m沘g+ѺO{l#"N_n]C!JJu`n~Cj3fXa)Sm.ؙL>3ѹhՖ 5 hm 8Τ/q(VA מ;J;fBM5<9 m^`T7!sDGr]Ji5m?Hv?L@P# U QrǖPbT68H"Y!Z#˚T`Ÿ[5!eR7R놞?Y ܅A#fl-ZzӔ)?,;ƒ!Rn!>@$JHHw tD^q m{ @M?:y(P<3d~X W0O8967⍃(5 $Ī?]62>@(4R[mM*IR[a'@߬3Y˕Z[}qRԡo5V $_F Eu(2OϚ-m˽n2@#eV3sK{ ߒJҋ@'ը\T5bXF^W8Hҙܥ '$mobj+̎.OmXC#qVO_돷އ+)ڶDN`$p_/ycOAm;jEywHpH밭6l/Ҟz%Whza5Nj7}DqoٺSx$'xGaOԧ74?`J?oL|Iջ *تܝA~nJOEaé& #:SJJtƖ|.iŷeZD:'HWTk>onNxiw奶ɔ _6?4]$mXng:Yf m߼-kt)I7 Bd?[m/ҋ/B?[\g _r;X}'7xk!4O PH+(vb[d&0ZoIMHCq!)m@.:q-_k^IK<0`so9lkiJ;Mr3w.Y|$֙N/Uٞ2ux].MB[Sn*Jzl97Y=FDr֊\"K{ԨƯ|NO6iJ+ Uwݯ op+;2u 65v BD̅=wF =) ؝qe,0 ;8&۽vy䶇@JBŋ߇gr]}YIJGJ4$ЃP~Y6fRIJ|+g޴PRX͂|nCcW)H[Bx*i RƪHLax-JR 씓2I{Ǽ]5rʜĮKQ|hzR,R9jX l}ѓ}Wcv JPUsVF}^sSj&p\ɕr:-N!¥/HBE$%OJVH/1qf$6qdSqvproz.XUԔ'wXnpyހR8)Ŝ\>$xee\\" *:@۞" ׮UOls^}~l;oҢ_1b~bTƒkZg֦BM$wXPhRyjK;xŵ'i%0u%J 来UtirB/m@#"2Igz]؎؃-*СGA0G)$YS o=g-nJ@R"MI.'oRı ROw'dIkvHp-{$ΩLn{FBS [rJpeR pV{vfHWi\_*o߄n})m+W6aв, .q8]!0}\+Rǥ2mCn#r1:u@[~$w)ZZq&5~ qj\6ޢLƜRޕ3~rVVH%#QRJ;lduiܱtKFʞnT:ޛ/.iK#v/,E;H썾TRm"w6Uv2Nb^)vߊr[y\> =1rͫ Rn!]Tz򩺌//mEv9m|HcFMn+cՁx\_o}x+jKHiIYȩze(mρqia2RK#A;V& KT#Xӎ_p-Dۨ4'MJvZ_£&lFluxOm#}\痕kkr:q2Yu ~oWvsC%\ )nORlN&}ǬH`I TI^Z'lZӸ'ߥ 5G/uT.6嫠[1b.r2OMV0·#\8Ta'j|R,1!љ T:Gs]ǹh&$d3Jg\XOaTiv$Z >45C64*=D582{gk~/|Ŝz q።ǛZJRRp>g&_OF?ŏڹ\PAZnI%2dfEGOn?Ʌ[sRUh^j`tX$Jt'nHڤn3nw1O{T8/Y0ܗ B˴m P؍Άduj.rhɥA3kWMԓ$}r'\ms8h*l*9IT^v3_Zi#PNZ5iӧ%-CĻqvR#mcTzm':b<;.%k}\4T yh훊A@T>2L0n208yFD'Bg;Nt۫ "Ÿu+}Kx d&v 7I/j*'q+:SS8jy7F|.SvV+HGP@CGˀ  DR'qmuܩZA^h)s&R:+iIRKw[ݯQ2Jfí@b65?UC'\lU*}tu5N[ÁAT¦I,d"7b1"@;E2KԿ㆙^Q/Tl"/$WOk\kY/I$wu=dgL^Q^q68%>΢P{˲R q,ՅY L K͕Fl,_8㹋 o/~ Mݸpc)c'$| И"|6Zq:=QCW8ؘcz~hy?arm\i5%c(| ~x2ᔥmOe|kQ;M~_&G&#9YKCzY:\B%:`v67Eϧt\=4Un֘ڸK! ijuY$vJTv^($Ȟe~4cNZwDy Bn@YrӴmpVYęg."sީiSO^&R*5j1t密2ISo}N*e%sv,)mw;%azH:)!ruXP߄ti"n3ڇ@O4fkgb- K&KƼfBQۖ4#g֮o:cc&k8>ͷ 6#s8bL-sWXhbm``7܅?e#un5qpeKzI.~HX:KH;-2 42E=?alx HQIڶCyҢZQB`H{O_KU\ [HwT}UMM!fId{3K>6Q;vձH4l=<76٩PvY v0~f,b}PFxc};PE@ E dZ jF;%sb#3Z]6/TXBRZAӦb=ޟ\"U]o׻PꖇnAH#t8}ȉgqG t*OV'E"=Ojmǚt;񩓮?lm(XkxIQu(@r Fy#bKbFB|gQNCaXs7o$$۴N":ps$ݤ@Iҥ$cj,m4KT/l*J+I֮& otd\q.T}Rv=樲&kFX^-j߬6ue6$JT LJbKR_;5-|$Cݑrq̅ĩ}s:MJot$6)`ӫt5#ám=)~g}ۥ ց Li$&.,٤mES~;ң?Y|u[x.&\\)" V#YJھ}^d[óU3ЖYm,NZQ G"YkFՈ9t nADtX"r(өUBs!}qp\;%hi'OvZ|KSn .4yVE*۷gy{bl!!/6LΒ$$GLjZY"vn~> %1֎]aopϐu2U:ҴF^t#Ku}R[]QHHLx}, 4aN(uOᑜOvfŋ=덽4`̘}LܶQLt(0;w]N*k䰲/`h7l:)[ "ժdp\4b mI;RFo$sc8Y3_-% Kƨx;TsR_PZBpxS:|>1AY*-{bWjjӨ%|R~ .Z(biF*һEʉ؈R:X=W΋Z|o}q$;sA]} r.6#+\w&:@ 0#Rxz-4&vM+ʦMmZvT6{Eh;Q•a^axո#؈#VzV_?WdԆbb[&];;zH$>SN&hEJoe'?螓Nn]2W7xq|UhT YuRt=t~+ߩdT.M R$!a>jV: 0 *=›;q: HLT u1:L*pmJ,PPzZQS:v1NgN}Wٟ[**Y!ډɑB_PlqoAWm04A+'9*ۋ, /=Ty3S Ijm~9ӈʏ lpW8:1ۓz-mQ "LuILh/ɾ> |ehUBQ4 TCVM>۷2~] 9WtzSwvcYpKӐރ w.;O4 WWJ@jXUrJ86B7^Đ[B@J#aTy3,roeEf|cK.<;cg`[^M+4-W ^T~QSȱe.? vbi[QX$0j&]mp"ĒO=GFp^d%A %;RJRkmU>WnGJ6Zn_P Jdb uL:q$aB9J0A)4j?զ#E<+e)q2ݴZ;`zDW!0t3^A v.%6c'' Ɵ7^"̹+GRza)Pg:fU mM,eJDžcWґޤC{,]Ob y($oP6Æ!iaXzieq[XqRdʎԒiaZm&-,>Z @>=<ْT`y+JtDإF%EdV}0AqNPYf[Cz=WK}dcMROA;\2b:ظB͞}$ú>Yt[JjS?%>[sm+PCu2=!<ͪZR!TKsͶ}i{jxo,'q&JfD'}jht5ݥhYWj/f‡ԞD-eVαw|!m72=вKm|\Ro0ʒTΥDn\qk[K#R 2>qqtr4UF=nN0pԥGdu`x#XSVն:FtUor_ Umv{aۍ!KVߛJ8hMtrϿeۏ˾cڮ^OŹJq}:g+ri\_Kmey \^:8I榖xkw̙>ggJK nI(>Gt\1U6BA ,g"[=,x5%Zդ) p}O8t¯e)xnn(J4'VLwOOxDa\Ҫ6-^$\8~Y[EvSmܟq^Yak6,)DL楇S+ʛ~Wwe7%jY Tue(oN nzCI,%Y)fSƻD djӏSM`meMƮ/M]WA=ÀGZM)5mX0fV>mzpCs_DIPzA&OFt%: ];TZK<qu}{Tڄ6f~2i6Щ 8PcċT= OvYx~2vD SIF_Q%O|ȒߵSc2q]qv$ljuU;T|" q.9l:xēnPsr0~p2G C> l\ҍ*7=G2'7 AZ! T;DtEsbzdz5Ҿy#>9unH rvv?^o[9\;{dه'|G$3)2nRizd t\6`ۏ}G:buT[鑒GsWKZNqK[s DԒ{l-8݂o2oL7~EAZ6MMa2{<lO juOqĠdl~4/-?p{; ERAAʩ*bH&J?4W4:1CX PDo߽5=<8Vi*FiMn(\s֘1H_֬VJLT29FAnEM0} ${/-~.Y``ɢn gGUwڕ)D#v[(BuorxЩ7L|zWj U*1/&yi1q $%p?*4-䖲ۺÛq*Q@~*9Z<^We;Lէe';UO'y5AU@*QwP1p樏íz'DD>zdknN]h@=zVYdVY Gqkxkd€P=dңmXɿ- ߔZ`ڜnak}َ2D42sMJ[>Ԃ5bMY2F*ضx뿴U]&Y1#ݱy*Th;QN:>P$!>>^l+QiEUo§] J׾jG$cËV^ȏPYv啓i )o;ʟ?B~#xG)_uǷqIYr$b4yXK>"="͏ܤ!~:_2>~6 iRᇺpAFtDmY-$HTjCWV廧Բ62jF+(o{l̴?Uj:o'(T5"@TpxE$DO;JX*؍PJ` 45<ԯ~t'mQ9b:'NDrb٣W. D6'<4Yb'L8t$~ԬOc{X}҃PY3$Joj )!PڳMxC匸I))D SJIoP${EPZ~*/ ra8SvZ[~^BD] kVkg |5~&)BO-p؎D{ GKNŗZILFwRxNQҔVlR&D[0`v/^6S,9ڹ32VbC5$pi6!2qch$M6R:بɉ<֎37[E~JQջc6)]a%Ny@C#*]4΄]T4ZJUmPra4>>'ޛǖV~&͵@JQ \+_z*|?e|oɷJi AQ{vy쒗gZ.z0N:u"vI#ΚۂeK|7p7"znꊌ "OLug 'W%ݖ?4׹pEDŽm*kkը[3ѵ}PM[q(|jKDŽfx!g|*ؕ nJ+#ZD:S:_ǕvuUSեazjnDZթ)LGچ562o>dvVJ}]`"7 ! SJRN`)"B3pi4饳eKEITRiM6~(bX^8)6ڑ%)2fGƍœjON,\uM?3a %S)?v|g8]6Ł㗏Py;T3"įjVHn3&7y ͛aiINi%j$܆8n̓]\d cqӡzj/NX^StЮHwJ'$StJGfjCMόX65KNJR й7.9^rʥ^sf;oqk{(\HvڬnIWgOb9 r'ZRP_)ںdvܫqRmx9zT=[_A}m.Xz3}ҟ$B38^Yx p >;qEI~F)~p]%AkOL&tV*7qwr[C&P}FVWIr*ox Z}$#敺etJƖy(FY#b3_el;Aoϧd:dY8\S#ėoF(P/˥1tW#cŭŽ<`KiGW4L:XDz#ppO]y'Q+Q2{WB$[X PHiXLmN{EZ˻= |i /(YLOANV]y )E=mx"+ !HWWQq𥣏 IB[#TpV 4Ӎ s8ᡗ-"($W]"SJJU%G:qG),ukP KhBG%edtFģߍ A@զl^z4éfS?CX;{'U9<쟩699l2-]hSGgڤT%_+22Sm.W(hr sxVDvzL[QphSd.K\+eMJmw?݊IV>YߛNrK{:ŎhFB6@%DKqGVNYb1${%AFԱ;|h ɑߘz,RC6 :fޭ~4m{XZ'iZ'#Ӻ9mWESsIUزܚɗ-M %1.,Id{CY䑩-RƥKn5SN@zz|~ jɟ)Rv w*|xd$v5x`}ZMw17Z,ۺFV5˷.a^jɥ6׼~Eޜ/$ڪ*{3 *qm&fzMh(u+e^szz'rTeFRIlM,6Ky?U GOoaC&=݈R)PT>4#qV8^Si (:Hp:tʊӥ}=sc,G3 dnQ:gs4,ɯdS[m_T߭Cu*3_gq=uzϓ#\VxN'j\T9(k69GL귿b ]Iq4YAD {^4ԓjo.q1K~8mamWu Pl@5/RMedFRTknSk 0^\Ü6ʝ@ Uc'ZW!?W+eNJ|ߝիSM|;/bLU%D1l>THno8B*0b6ÛNisfRx t_rWa9}pȂ@lv9[Xy-%K&7H0>u -FW['ǟ4%83 5^t&B8.{!XK(d9pNF?eI8x|\Xܛ1;s>֯]%K,2Ȋī0%g $z|(=ݒL2?nQ)Hw Z㸍l7f;[܁-CcMǽ($Y"*2?UY5<^BY0vWƍ~v]$,FJԶ6⣒|]3ڱ*w@=O5bFiOSqvJ)͌Hj8rV @HD'zAɗ">#ꢋJPnjꕤϴ~‘!Xe:JS "biaIe7̏K[bIˋ[] @Ԏkzt\ajh:ceISj׺&l<pR·I1JNޘw9̏*C@{)VfѝJX;LSj6+e_Z8摈^-*ȉ-5XVJ*P:`?1;|+TmڝZoazhgb-\cX6|4/kpQdGd;hPuC?G'_ށIqGOUѕj-qF y,g);mZGTWKe<&ݰ}@I lMneC e9P=niAx_TF~hIxاb ;8?? z!݌AD C'Re>ۉ>ߩ{l Ɛ6B˫3%xҕ=>t`~cb}6_腞NL_C`6+5\b|+Mսp۶Zj!mx?n/ICM\V۩; ò_p謒`EpRǖ4*=L~(Hwo =`Ҷֱ}h3wN aDPœ ME @ ؈߂ Z}<)vW9$Yp[5H"{}vj/4q,9eFgNǽ=e_I/Kk֒8JT$ y_:#xk`Jebg7_ΔWzq!1ūOMwzy_D.Q]dO yVW]6;piiz/_E -ax~)ԂH[;csKk. ߤ~\uu W!FznI-} Wq=h[zCNÁZG,r`EgtNOL2IN$Ւ4BHjOuT8[-QYgЮg(ً'eS?Ғ$!\ ~)[W锻{3_ܽ Yeӏd%ԋ ()Nڠt$njIOW,*J%ߒ#wnX]%. •OQVyŽP{o<+OUIGzߢGZ[V]J<%!ԍW)IFY|~Fۍ>3=w;SrO>ȝ}#0 " 8תqFJv W;vT؜$wuS}@_Mc!eЕ8^*5(4X9os.a8en p(t<0y64,z6䜞݇,Mݫcl8* 0|Պǡ5CA02UuP0??iG"ƪ TZ|*S>ڒ>~é/c ^f K1U;̹OcϰPD~TƼ߰1eZŝ^AHK?Q{>w^bnرSJ*ZIn*E:Ɵ)g 㸭uCb~P(S>ōut5f~TVne+=YtWvWO j4&Jku2\zcIpyQq^]MT&d,>uf݉6 ›X XQ {H,O4pZD@*UѮ泃Ys a*@Rz,57p<6jZ4oLTZPf%M@Ӽ5 ͽ!ZG5Nb.) ugZ}QM8V,$ )^>8q֜j' 91)K>gXMR8q[MZԡJu>uL*LqKTu7I$ N:s&? Ku+TqؗG+E(t:HWZVp8`N$RاV CߝSSϔ$MhZYDJjo\ob+E9t>⒬-܀Q)eIxpHR0vZt:Of@򶘧:fۖƥBQ3޿ (VG䚊Rcs Pr %kZ$2E++DZ6;ɝ ȥ:NݍM Vs<R[)V ( 53YӫЮ/~kM oɻv6Z,-g'jLKr%[F3\]qH0填ty*Bԁ0Ρ@t]BIq~91pm@1=⮳5qR-nϹdd a/fB_mTcejZO,I5\us 7(p[D%LmDtՂŎiR[ύ' 8fk0MjÖZRƇ7%'ˆ0G3Jke"}o,QI )VLJ[y>ɋlFAWQ+9S{}ݐu6TGuQ`K |Ș5轿n V#NN:#N,kňWWe [KJ6v =Txq_Ǎ8%!9͹Ѵ+Vzõix8KoBH:ٻCJz?|ZkTRkq4%12=z$T.h)zMrirv^mV {sR ]ĩJ;VjtiO2 v6~($%$|x?͏1jתds} }LRڧh eRkM|Jܞ>Ži[6X*+ rIl!/1ԩksդTeX,-GSVSZv5v<.y`-<+Qw:A+i%MTv[tU_f/oۋ6!'%~,uEҏ JJSl$3I>ܧw។.-,ce<"TNfCK W}zd!>o057rar+vGԓJscݕl_%܌l7lV5'KiWa@ŮtE2*^}ԲڝPH+Q)h0O솤*yw 4&#߭{ aԵG?-]~Y瓋 K4 -1یUt~JTˈv?iV'MJMM%%+n]>em=6xBIx|jN4z&yWޟHrt'YfcI{,KEJcc'SI,oUOn~ntz{ak/^mIl:F(㉷NYpNt^:]. ׾qZP>x= [2Rkm'8&/АĈ q#n6Ӯ9GԢ]uR\^;$QQCՐsvoRt$I 'azM'nƙJVLL?M)FN3j++@@"@pA*2VyF+ &,7̀Q8iٗ^-2Bg_I>}E=OL=O岦{TU '4VOR\6 !#Z&<[(Öv`wKrJdpn/BS|q_K6ln)> ISܒ-c\J W̜W?j*5|^5/Xpu-ZjT'Oj"B݋ԦZIT)6㈰uukD)v"7ِImIg~&idMl9G&>AZUh; @Rhύաe5,]mD;weX5vyR0۠WTHzQXnVw&هkK"G2=9ie|!iMBoNj$$V垮ppZ/9FOǭ7$x!CP@CBNX{~[:vgާ{Պr$QƤzh&Wa6%D~X4:7%mu[ee)QU^TPm+ka (~[_{ӡ+OsnNOh%\]Ӂd8'Ǡ«TݼHI9$U^ ᨐIPƇs ?e&Jl9=ZI;rH).ŪX $'JGNſ/\EZk$db"JN.6LϹ3ڱɉpÍ-@ AKjlz% p+JTc}ԭ_tDr"8♵eA;(JCwd6K>'b[9 BQA %PBTv )@xTl,YY^.$zBǓTrE䙐f|ijR%O/}Ͻl|[?WŢBnZˋa2R~馔R=.ڝ?OꇖIyi]#mGF/e6Nb{VqH#ץ0}N4BNA"ilC%hXm :+GlIۑMF le;}WXH[AfWU|v[ֶtOP \Zo\ՈA="AGȪ>8_Ms5,c izMk:g1bԧSjR$Hv̂wfr7= d0;o;E[^9˶v״'I=8=j 2JnYoT)*T ,_mA6e jOQ)E*~\]jx}C͸Zq*dKҡ$JŁ6*j@mdJ65.0g%I( F>R-/FFrC<.[f7OU)>b):{%RQ Y6.) `l@ۊo Sî1m<_ބ#z|0c`CE @;|:+/l*~8@R <"6$niDRG BBajl߶vih_K  ( |E/#hs2>4K#P"OM旞 )_}uG+~ʮ[QI 3S5QH`u [R娑JreOu G,k"P=c=1=68${f-۴u`$u C󮳨\=?3Ju B>IpΔ;#q;)lAAq#xZ?Md]gQ-_菕-tG#?Pc~4x=®%j\nE8FtOud(h *;S,Z<1J2?!Ou%d﨎MrhJ>Zʎ&[GE\4vHKGڈ$ ďzklJb{-墛KVj j7)?uvT+cw8!&Tt9l?.-YtQ~hbQk>ڭq'ZH;54'?NΖW-ReOXI[B&[@٩l,*GB_=8jH=(zMp0[$EI7[ b\CЃDHا*5^TQ簨fQC̊=]HrGP Tpj>.>E]%9r7XE[rC'W?̙S[m~PBVcIjL.)>W ^X<;=XiZ:%@pp(8趓bxIMz?Q 9ՔcV]l,snڝ@#eQm539M{.Ƚ1pq<Hݥ+^AH?x,/Wv NFۭ ٝ *6 *a?i$zxgU7v}dn6~(|c-b`7 ӣJ{)'VJ>Y)-Z>KG>fK vPi~1}.I(%]hd0a0fIF#rTFȩ:,i6/~8.gmcapMn F2~rI=M$H?ic4vǧ;X"Omb $UFIÌ&˄#ySEZԹhsv]) 'BOM?$r7lK:UFhS{PY^a@ )bnv:ƩfB经GO]j1-[u)t4ԣ5[2ulr'BBIMTiJ/[_A?ciK).9OU\GjZ_xՎ=ilw {EA*>w$8&) XnOyg>~h|v?3Eū6m! OwH)?ջ~W1;p'r*ɦYar 4y]uNR4NI&Z~t2a9}ra-%GStJ~n[.qW)M(@WD?5zZ^UZ8^JL(U,Q6([+į^nVCi% I; 9/SUE,[-^3udmieFh-&5'ov/i/56>&(7yfoq~W%J6M#R K H2 sRJu=V\%TB`i2ˡ%DMRUڈ*T5!nm);$za,WUN1bi[Mˏݾ<&`{{V#OKTޯ~=ŋaǜ`>> QOҖˋHڪ4EZZz1+ʘRA'#rɺ'OU'!V6;iW1H5dxzaoOkB$]v\tRq'N:뉍@G4 *gygqܕVv)[ALzQ8T'yzmˋ({QI%_)$nLxV_>G<8%7 ,]Da*Gqr&B}腓mu?s^[ tݲHV۬TܦFUaP)։Om#hNʨg[EyOiq`mNّp9ab(Q)OS,!Ji+'j#JMǏ6&kbC'gAI<5]awil 6} b Խsǵc*;X #zY^[LD ~%!N*4A$,ߚ$Zgd`JagQ߿ȊVIUvaDR|NVzŗ:6j r#-ETIV$;я \o6η-ON}|{|8.k:W"|T"x#Rs\H$%J p5hMi-1:{¥/'`]yGrfw#[ )HR")EQCK+ 䅪g *ظEN.nmz#vM,\6d7Na"DՓD^կChOa)u;|4(4Z'E lzod^^[u#h֝1gÒIDu^{>49})>W _^p2my ވm-Mc]؂z2`wgJZv߹ U U)ARZ QI1i~`$,$iӆOýqe#h$L?1! zT=sJ%K{TOKHPZո81b .<jK%4FtI4p|SmB@lgNK1n##啡[~)6NnHQHme;L+3q൹r`(zZŰA&D"kn1pI)?4'gQ=P|Ƴ*o4q'.6]m$~N6h1-)_KbPM62 :hAq`'N)$oHrKʙJun5-zmtڗA=;OVLZ 4ʡb˷8sᳲpLmޕؗ6 H})2J ", 喂ߡ):F*aVP$*:*|郉U ^ɐLNkC ް%a+?9{Rr{7Mí줘ߘ SZ>ؕe+uvIiN "hOXSÚ Ai*T"8+?[=bekX$x#[ɯȻ#<]X*X?en:uG~Owe~B"Ac6a^mӊ1$6ƹ,2?v.*1Êo]/+V){Rw'ݩ(mjDH'vF!uw[JL@{HJ>Pӟl&B?4& cn^Ds s8&{]%J$؝gz |<p,~TJC RBDmQK_7W+fHeDAۑ[v=ڊ%0TNƉ¾H\uazt$IM8ee DWdBT!A4mӺe1;6I~^_$G9[4+ 2})lBZt)K0JoJЈjnO*C[M $6FOJl˸RmNHc{DOmwޫy\-b. 1$8UD#GI 2mgCPFݽ72ǟ]=UXpV(uCVāJIN,?J^/Qirjᙯ0vZiADuhp)FJQt|ę3# %X}:]p*A:t(]LWOdeiM쟧r9iN8KMr}Gi5BJŮi#&n݀Tӎ'Ҝz[a)RB9E0&#-SP~ٱV%P8M.D@IO^#C6 A2GRFieD{Qk}0<#R~.yd i:/z͸[Gc?U+cV뭶@ B"8͢RYY]hHy%=‰_(, д7Pq`7~N\RkglLMsBk@R |5 Cxm`'58[߼rvqjr4(ʗ9xgr%˵,S+(QX杨?eJjƓP=5JH֟ݱ0W9֎aC1;u4sa]'=iFВƛh]$;ʸOVTf@;@eG\6ouAko]r$:9)rZc6[:j~̥{|V9F6n E22QdWRAlP[I:u'ԩެ1EG"<3 g-* :\؞MZVxL$*asCx 1IAI=鲶B- x-u52<=[΋Q{q,AuŢtDDPϥQT5:G,Ĭje ?Ht5GI.UA*+{k]0nFAR Ch/)KZx<"wx*ҕmSm.R}ހzXd_xo] \0L@ҦbuuA!,-JkS=^k,@W2H0*I?;&FҒUm)'9Z _ M_Y1[%zᵍ),>s@ɽ./oQ4E/fiK]սKog 7%jARӲ@x硱CWJ ^)ʧ~4U-b~? !ʹv Bzu6{ӖG1 L(jaLsc6ă11E3-)%TPTGƻPhPz|Ԭv/Arɘv"v&Aښ! PFV Q"cf7q [ !Hdfti>jBIPqH2ۧ{ kT L:N أi# tSdرV57-$j[ q$SV5C|ԖYpA$ߚd 8䰓?HV6[[ba,媎t)8d6Ucԏ6W j`Wh1n*8JɝR)Cf- [6넓$l~">u(} QȒ,o}}Dw3Lhzg` "BU:2R{ßIGɴiӨBo>c=nRR !D;SVÙȕ\y! VH-֧i+Io4ʺJmI!Ip(+ )7:$O\L\5"G-h &SStRgU1VcQȖݴ]Cꘑoӽ6Uո`ImZAG<-i`ew9EiP$H*f}tw[6f&Ro2˥1&UEE'jK >xj[|kxpn>_'~QW_XdھHpnI-q"C.SoA@xg`d-s}<}+/?5vM[0@%ch;1k'b埤w` i1W}z ~%dlaeC^$JwF}#OAЄ[@ F@ 2`t%J!qeVTdNR\ڣAڭC.,Ϗm#mjT˥~a=Y[coqq&0kUi0$RW<>$Yl!d³8óZwt# mDȐV*: .)R=A+@ωI5?es}ÕjAi'x5#:,%hEBPyIԩG`HL T9Vx𤳄+Q{ 3M-r1oJ([iv޹ ]-1mаtO;E`֮-Ɛ< L'-7v̉PShQ6I Shu^f mIGXҗ BADg!{O)GM M*8snTNV7;Ї^`BRO8NW!{RPM4S&T5dg!E)R-[lRyN=;X:nkGEApi,J=6Z1G`iu B5fA4u s \!n޹H㮙+VI*%0Hc[RF\mjْT[Q2ӻ%Vx 齾0!@ަy|ũSIf_۶'[4_Zl,R]z9&wq%;ˉL)@j0#m z|qQ6W W'%[q{F45Q Nl*0R2:/ÈIUMuk!VT @ XV.Pbvڮƣ[{WGՙJ9H0ev[Q^]8Eiݩe_U$hf|igjoBJ.B s53`vHbl%bݷ MrJmԺB}bɌzP䒊y zHg ZR~reOfo#Vr\RĠ#޺}!PgP@livHDktaFH:gjL^+QIwX$Lb. 3aM>V(#Eu`6բR{T.ĭc(_BT9 I}暶H-.$ +Qj1jtIc+m'M9p5Eq[=@:QH#}%E[|> !Ri؊Z6 zwq\莘Kn$LS#\^q\2~3Mh4JS"{%?mm45bUco|ljC}qt$߸%C۱ !@IIIOHȾ*Ê ӱp;*)"dwWB L~&c8Hw)JyPHdQ_*t|7/x'[xㅒ?$N mDLzwjNzm #8'RP~J1Lc& +TNA\9;Gm*5 )goZrC_=*, kmN@="ņ\;.%)AYLƚ9r^ؤ?sME™q?iX%L8U:qHO#Ѐ F=@JuGꦎۂ0 GbBYB?ސQԋEHR#,YHV? LEr[YQ߶IK|o:N}Gw̽Jd! ϽD {Ķm(`fNO rҒM Nt59ag_Uu_~Rv3lv׉]}u5Ԍ"QJ̩o:ڒYӇ$[)$4*r5ʣɊ^_<]k0PK‹ qv|҄RS K%DPIOpͪ,Cs#~p*6a _YoZyF}'n*_6QA[츰?[gPWhh*i([eH6)=% 7R.'Jvo]BݱKLqڕ [V.iJE׾TC>7JDº} ͌z ]]Cn *Ci >4r`J8jr!@Fws;&ڮٴ%H 07sSASS>`e;DcҠ DF}<of-ZOO,ӛcwY6TH<m.MŬ2Th[Jߍ#H0 ҚXDT˂c֣m(lj-ӸO))i"5e!t68ڀ[7I!n'sx%Œ Hi#H җ$]:HQ $\S$ jإJm)$o]\m\-ٷ}SQr%&>PaϮS,Yir@E;t.P(\m mjdƊ^-p;sJGFyK}eJ9lB>qFRH&} TZQc$Ǯ{vF?0Pi5Bcq%DE7UB)JN牮%_֑q]gPTARr:˺I:= upS R 뤱oINk`5±= ΓȮI P5 ˄JT NХRɃTƒD߲*Ԛ8,Fu GJ}@znx2ړ;WY Si:dRnb`B[ A?rg.oH$ɔlSIWd"=;OKl hRJߙ WL$)J4ta7m߹ibX8K)sKGmSXA()Igd73Kb:)Ab沋'd ]YZ>U3]S9WZmөq FݻRIlFJ8pVZekKYaO#[vBQ($Oh&aF7n/қ"G+Dj+QhҁGʙ G0, $4IVƒnMᤞLШjқ$yY 8G>5-7[%CnTCpH`}5 Q&κ"c$cj ^t)PiWګŒ'c<%K-0.7rNH~."-YmutJl(h\nW7[|d & /m] [ZYvTo(r'⡟BMJ_#Nz"ݿ-շtT:'37m۱<3 ?s 68it-ZO+햧t\J$ܷ|]Vބr~oI7$;Z-[*O4 Jq oVr1~J[d$|w}Fʻ IKkJRgZDoAo~)u.map?'J\}S,כ;": =Ct~\,-ʵajCxjoW ZM@qCa37ICNlBVJ0#ڛIwkqe K60]slט߯'ZrqF'pF];∎(SkjB+fR ly8LΓm ]NUvְ뗽a RGPS& s}MhlDJ"{MuVy~e@G먭,"[< jВeF7Rʤm}+rkJCq^`) hKa ǟMk.Ԓ[2g!ví)`(iJAiA[}R{TN :Sy_Pj ⎻Aih>ZB$ʻGC<V}d)|zX%N+MsvbW7fVxBR::Ad-"pW{5F=lg@bq8⯲ \=1ޅ6k;|5-YLH[M,ݿ2i =Tgڭ!ةe}MB qcb ߯jdGqY V?9 'd9{^P=Cޕlpd!QrB1!:R$%'T G:ǭwe NJӣWq}Xr8I)t;Z8#hFcKpkZ$EI(Upz kbb(:<Jx/-7~O)?6PڦHG: حO%h26}LrL|oBHOM|wҡYnyʁho`%rP1҃GR<[܆PLË5uHCBnROڣ$;Bxv?҈")@A"8SΑ)PԤ2pӻ*Z m>#M kV:tWD#GgJ j=D Ҁ bN!R"6WpO?)7jyI*$-c(,Tg#m(&JoPӵ6-::@D?DTTz?ʕӗ"x~dtH_ 㐂Ħ?]*9+W+ZQRG%cū #b~;s8P$&ci8ܥD?92iT-.͵"A::|.>_?A0=u!ջk5qMwKRRz~ i P+%ĭm(k|(J l L-TN 1LNGo3eH?4O4Õ̾H( Lv"?^5 {# dIۀd Ң?Uw~*2e%%A N!x.FzJtR[f/^hLdz3$+cN*\j(d(A;{9x%!767-Ia?b SFzfst2~Wc[VMq>z3*F/比R3/]!iAP BN܃'tb>m@:*%:ة\>[8r3' Qr;6>JTup|)-zgHQ(̖'ѥjSҸ:=tUqVϷܘNr ťZB|BP0=:zQ|r?5fi1BŠG%iLRgqR .V2R48t—j :z#6BFc5-, LĄ8kfAgrl J'oƺ۴[Ym߸O:wE )Ve;R4*dvŴNAv"9,:ҹ!lOMPru:}<0CXA'@U13xwͲ [?1?tvt/dY* 1[Ou@u RyTMJR'I{W*cWm׸<1m<L}I_~1l *˼UyIӰjd'g9JTx⅗hv%.1(JzOݯ?qw,(R+_SR!"FbwCWU;(`-0P 8rR-_ NRuT( <аB"AW!CpipڟagdzKpq.qu32uBYNڎUVR@Sڛ G+lZ@J@Ξ!hyػ-P=)[:踴dN6Hke'$uhas{ߨs\uAKƒH >Vߘ;#.A:a vC8KGs(WfR+Q&>pţ^H.6"A#9vXRzim񥱧4~6+8P;m!*1U-[2V `w'-+eq -~][mIڒxCVn)ڒu>ڒ6;% S ;+HG֎J'߁8gnЄ U@[GW8B[NgojGQ(sIe[0I}vtƘz@iuDy#bUNCMˁ e0L<Ɯ$Ma[[P$)al$9p](ʁ&Q5@Q^5*&&wpʫ&C%*<GQƳ)8an„Es[-jL7c] l(+8NbRTX0NNNJM-g1gvD(svqᏔ }g\%*iXچrN lJ`ֵ%I?u7Ay%aa亻;DBJ R]ZI+h[k֨BtAApAAA朆}nڅLoRtTY/JڒTJ%׆[ln瘂uX(in>ZwEpÍia?PN N`W/Ye%5ٍ8MbѰ*ƁNR#zkqخ>չ &*eK.>pNvS䤞ifr[a^0]2y?pm?Qچ>g+fR2:*Qj}Evd)z{}IQy*G vG1.Ӗx wcƼ^}Wա <"*?>뢶+#:RspNSffl,OIv9/ $MLZdzBB  1GuϸŲ~;; z@K~ _ېR|CܶCV/2vy_.XJJ!B~N^;EJ֖&Ɋ{C+t97p:|w# Ę';z>Oc} X/TyR{v(68 R6=GIŒnd [/Q[|+o(J RI܊L] Ա^. P-.JO˩qQ{rƹL.nyo$$TyUi}y4ҫպm WҪDkk޷jT([|jcj'_f2%~9[OۭWk. t;  #ҷzVˮ._I\ǖzvaӲd6Geu{_8▄HNPo+ro%AZf)gim5$Qc&!r?mH"h/B0*43"QfQQ9 3 [#?BibU<4kNıT7#A !@ %aEW(W!ςn ;,un\ZޕA~\T }j>nɽ{X֩X]i M>\dz=TTN,z ))M'"J+iPO#JIRD?B"֏H;\ƫ4􃷹JGNj*(v,' 0ؓ4T\Dm$/JtnZL` PhG(zRoⒿaCJuQ: ~L(fckX7s m0*,uܾCJ$nٞQOJuHiK]"gUd6osv>zQRQ}B#/eơp삇M0qݻRF&=9l67$mHƎwoAԨ((Ln~0'NXQOBRVct ݸ6 PBJRO`҈!%WhJHA#mL%ӄ,-a BoDq̓>\A+F$' 7|܇/Q`9mqF!6GOgjAOV)\AWH-WѱIBX!M'FOҥ@4% ˒ zNBsH$@W;{v- Z\Nmm;tA͕!Bb{qÂZ]ջZ ͯ߈'lr}[:1MG4,YbE֤<sU\@xX[Ϋ&OSta^n8G]N*bA$`JvӔe(ޔ  cXH*')i^hbkCSC$:rcqAM#rO§ka%ZM5A(t-0FUW.![mJt۠4>V6FԱs^6vɸKhZ[pmֻsHu%ou^y7 %AMUP1:IvHSU#0@/+F B\6G:}KW-_L2u;>d ȔleQG 5hKRJS&AN;¥7 }Y ?tj'SvmnA eCoh8w<$;u=؇JUJF7qK#WQǕZ`]K? ҈=zv^$Uڎ-uthO,BAb?cb?m/&2:wv}Z]w&2Q:?mwv iys p";QM%J/jMj=VZP(=tp{nIRww_&;I Wjv,efң)4gm؅ʢH{,gif ANEe2kOƝK$i'o`i4g5[>$ (=H24OZ](Cx-m.kI Qw#hB5mV$i&t?vuШz@Є95-)#*: #4pM>upCJegTJY-!E 1Mq86a$Du5<5r#T'mw hi:# ƀRQy"6RPTäQ)}@![\R4p}#I¥9l,N–8۬Ğ6ޓcI] 'Lk8Jgpq/JA&q"$):wJc T vLҎ<)u+}%Rh;ش~ųJ#O5܉BkiSavŸQ:W1?V^n:}% pvɤucWHH&O;q4- ǘtE)7,p(O)RF0%%S̉ )R,ݱ]G+@+$=;WS^KN#NQ׷by܀_Xᷴu-jFTO@:;~wZD:g{Q;@?SZ\!)hyOƚ=ZxO4l R\(r$iZ#7HrTsnCẐv4Ѝة8[Ҥ#SR^č՛#M]d uҴQ-oNj >'{eod:#>4 Q}V"Ƚ%ӹ>D$gڞ#3j( ̂kc9Zҩ<͊RTYB ^}L??tҳՈ,Mdr=&!k JIؙ4~BqyCӱM?)I 岔cҙCM(!O)ǻkKN(PTg5#}Uuڵ06x8xL'>#dqVxj#\C."?l"2* i$􏺹 ƷT]d)%.ᢣRwؕ!jVfP`i9<ܩO JwH1ژ93ƥQicϙ4=? z迨}m4z:a*I>BCQFWbj(]w+$ >_(OR .a⤄J~TGbH *yA5b 0:ISEgvSIԳ2?HM_Vw.+o1ӈqWQ'INҠ'W5Ɏ(uk>ۄrAHpԶ`H(mk#@HN:=#6 ӆvR&>{R.ңtΥ"'zU=vNd ZeJL{Y߀8$%Rԡ' n ̷>|1'|Ww YGKe_Y ,mŽLR bP4v1114_\!e-iE(Q`=b t ㉅q3heG=g%7(!fN{VcߗH3USۖb6vwt[92<zel:aRw$tfA؁֝ȩ j ԭEɀO>9ݬ,"6JփkpM0<cqMԦʵah<\\O%YcCaJGie{ZUC>͑=I-Ĩ{$zq5%Mh($U]*NZUFR& m▘w4nZ'ƮqA4Vw,n{ȹY#Kw:۷qy kCKz^ԻE6-@NTOg$- L-.i|;HڔAK!H= fyasx^Us )Op$&>^yDDiN?@ҀM-qx\ #}4p޵޺$sMvדĤsSLOaR؂-NRA@>up]?#X%UV|&۹poVHRY"3yCۖ"Pgs liPIH}V JFf9bH:N!IgQպ`b[ I5"k^%`; 8vZ!z@*(_usXfcHAIuZ*"O} V5*[q}%I`meb8zylB#ֺ91([@y˲%@H>9usחu}aԭMT8qLiR\Ícwn[a&4L%DOtVO&xG^۶XND)=Ae<$ьR9? 9 堒9QV◶dҕob;<Wv ?qۉl!Z ??.rݹJApH1-+Yp?MqQHKm,6ӭ5l/#f -=MbJZNϡxz%Iq0 j_sԃlx_IH'"DNo]*HF8<=JXuhRB@ڠx_Qe 0T; $Li m.o&A&`6Q]͉֠:|1m?j =(l:J֑N-tD%Ioj$O{=qpぼʴ#(q3Е|SP"ǡSo I3B3®Yp$@NΡn"AbXeIn"WwiDF1PQ2G4bi ij:sm0F*7-Ո8-i)lӘir#b62D:`wHLABH]mp.5iTU" *:}CB͵!Z"zB6*RzsӨ?^;Fq%S o6rGՌ+ct/ˣP3 EJMG? [1@0 sJr 9$A0Tʼ裷R -O4P[IGGM6tQlT4i{!/j\)k}Z'TmPR o 㨟?]qeMT?M4QK)([M+N׫nFN.=ZU13j*V6GȊ2~>C&^Kиb#Qc ,w u P r-q,qwilw0᲋R>zz_Y;– *B3K5HpdVIu+})ݭ zc]qӍ'}~6V-$I;jPHУ:KM1K$j& s6\\L\n)n,L*7P8RtI[-8b^Yx^`ATpu2vQ8V2|0oٙd{mdyTV7Y2K~)q1eM)1Na_7&cʔc!gFGUtlXuHBRd/x9R@&N=8K?T6S'IG1N)ݦ\ JpŲhZ?֚s?oZ"ȫsB͗0AO;zB2S:0 $ ll@pdቔGv-%LX# H:hD|5Ѩ) oԊQhv 0GFj- I{/q=ߘ!O%{p S5 sqVH.8@FSҜC{v_;f{" t+wi WjHǿ ?L ۵zѕyIZރ˛S&X}ReZKĂ]('KJ}GqV.m+-͖2[BaZVQRJU^xEʱ{WwHa[e<T95([[$I$ht"piJ(鰙i,s$@b 7MgԢH=G—Iq[7P-I>[P\_6`6':;p!J9!,utҔ;>Vpҥʶ#`y~e3]-)뛆`'lh)#&~¾MQ:ʼnmKP:  Qd:ZˠtXM6wK.?hq֖GtJN$:]޶ J4 SBYnzޞR:MT1Rأ=LH$R ZO&xn%7Vm?`rNfknO_SBipS*<F?U5Z8yZQb? &q^iGRN؇F/q)9~XV%zKC~#TSvF!v?nuB/<䷹u9AqwynС M”?vs{H8rm]@׏ӹ8O: Wv8ptR}II_M[gؑ̅9 r,6yi#"qiKȂDK޽7i& cޙMdyCK؊AP?7ٍ֏~YQ+gvyRb9ccORR|&.G^[*k1?Hyz1<2ƜI))D;G_][Z8_="?o/AuQ=YQRL V[Gy+>rRݫ.$o߶OݑTB'?c_H~RvI]. 7Ip3R6]L?T5]xvnsk*!#x!N]|&7+g\62 ?pbE._ŘǐI5?أ 3Gm %R.>xϴb>yAP'oJFA yƗsfu *Jxz!#cy8鲁4TWڤF0FS.)'K"[fSh)*LJ]^mn=wԆ$Ğd cGffQJvVGv17籙N\\R+b>{՗7%Lk7Xhv!ñ Շ< zn+Aa87 u+ֆw?᳔k\+ZUO&yw=PHҳUD9I3@J "Ins} =n!<#nR~3MqlWWj⽀#Ƙ]hQ(pjґw=a Je 9RˏMF$%SI ^ r8^!w j,Y!}àDq2>56FuҢ3zn$NUƮ. V롍Վj7mݚϜ;t3Eb꣓1QLT4!toaϓͥu$I_ 1;u$+mRb"gҡ-x?u:]?z`uR(O3NlDP_XPjR>AIQ@N"wǘOZ tU 5$%Mj w?daH:NjujnJƒ1M"6APTDzF"gFJƥHsgWPJ4l~PQP܈iR&xO;a~R;5%iJD?lWxq8gJ5S9 >u- % =\~e_:X:A$[0ЫT.x>Z~@OJCx>* =O1ɝ!Dy1= T$'kRZ"7*Q똩{;fؗ+> pYajHEg[Y;y2E;WWINB0xM\9?,#.,;f[ [sQ$ &oɒQop.ͨqv!>]+ a%m(#:E:K;ئԑ";e=DF͆I˘n4/mfO%nyP{TmwKG0'rRaKI8~yJB.@'qnR<3 >bObeR# 0fei2?s&9h1 Iš-- P GX~ƻSHsC[E҂m"upԢTzj[HηTF?qOmt:IZ+hJԠ'L|ɴ#= ' FplWGSm~uIrRgc?sKJ? HL@Y m-P< %~=6ޔ RR @ҸS:dɘ?DzX$,F/5 LZoM]f?_"^V/Ju*i\H$2RL ~#7H9۸m6-i*{sM~'Go?B]Qs?1z_s{n~@ʓIE7 .V%((Xo`\}ONm>`VƯ*"t?)ږ=T1By)w".G (]S'H }Q*w(M>Y6@Tn$ǰ؏OE%ܰذDv%?en;{POWx:TV/-TδIa%?ĎI6a1̕,QВ`l+q|IWi QORdOc?@7+12?.ԛ[C~!kitC΂7J~F)\/,H,N4(P֔,*:iv_gb+iŤ 'It˷.rd@QQ?Qs]$% erCR;q˯'YӦDmڹkvA-湦AUY̘9|"]קJ2A4 A*"ǿ1<盛5],괁)'ڢdH; i~jTWr%D4C3 ra!ShqpHR1|ihMa*v;Ң$öJ֒b9UEG,`!))e?Rzc_[(ն1Q"{@[ZTdT2;W1Q(* Fw*ނ>1PdoL:%M)j<8~3 t8;r$5G(b8w\ VAQ"'9Rp%Q"O5C(bʽeĢGb'bU~BO-~`δBm$D0mCR:Z5(:Y% O^]U#$($ J;PuINևvY"B?ؾ@1MHs=^'ɕ%Z+쥗jxʷU$ҝygݷ$ 4X>xh=~"> t˴%z,<ДY7*î|NʹR~$쿟:_h|+eUx/XF1c|*Ce5%6JLzN*d\(֋_'wo%c*P4VKͩ4W1X13́bU E/.-+d eÊし07tNOՔ((zb`,lmg(3r,7MO$8ӋB1aԝ꒤C2kOf#<skuVa6Uw4É<wϩ;c&2A}|Ln2[$QK2E,3 rіT! q:G (@Af~y.b4wڠä}DʉމZgݢS}V5cw Jt#yJ1MsK~Η/&2 %^:v%*OQoG,l'0?Oq]3 +JWDrFb8֙mػ"yYڀa D6P9Z5vǙhZL34prRIR ۙZ^c;@Tw3߼T%>L6R$0)DǟzU/a)CZIHOEu)1;:M?<n6Lj#;/v@7uK&/ J@$S׾uwB6em q7.4S[Of@?}9T%SBՅ6'`Go?wMRZR&wTlZy0c쩪cmb6+&S& ]h. N@0>jyJN.gJA ?gڑ =x *yF~7؂+oF p30@í,]PeJoI )nxgS@>_Q{wFߍ#:ş1Kt\){*CoiRA>tpd6K)IT=m:C՞t.'ɁT$r$ۭ.bCm6GQaUYu={zRe=zR6c%ҖPSƒpd߯9<;u R[C4|D;#B 0ܝƢ ǴE5~hLW(UѴ {H{](hwP2ƕ @ꝩ仱4/C>VDFQ#omت)&XTͳIQwcmX)}h)-IٝC@ȭ[T4q6-% .#w=Tu /]<11}- [ət5[4jޝgQ錧FO}m4QYIe'BIi󮳏AYB?)9BҒ'J6uIG1[(Zۯƺ9{[?lK06 w|F۪IOcW,9vA4TOre[~=M$rǡӱے;npɌ%|㶖WTAO £v櫗Npw&hfO/mZѭ\Q- {ߪ3t@v|n؆wbHI?I8nI_BWmb=eZtSt.ݝ B$9U [^|Xmi^܍R-(p&#ojaۣ,q1阞uJ;VV@ڒP!*OQ)a8*8J7܂M+:%KCI;~m}qךdJ^fRd晦.եDj[N1T҉$; $~)I!\ k" qca$7Ji@~W!-ܫ93ԉ vLgFZ\I'ߨ~LiC.c6{v5w%qMAJb:Cyrb;Wq+ #j;l~'q"K(HQv?oR%ؘii-[*IҤ#gY6蓹#ir2WJҀ$9VĐ \)ƙ0RIGOY_A1ְVtB=It'UQa#p -ժJTI. ;Orҭ~qŲV-97v \e ~Tyc=_z,n.췔/޸ft<׫K+.py"2N'^NJj㹀~G^CﬖDI'yHSIcfvˣ4޷jlTK#}Hm%e$H)IzN>qN7S6vc3&9f>R"KKeR4gڲƾs/=bő&4`>W}b:7WL'M sfM/D?.cǰ\h9lY_DI!$ H=de3ENiļ2⑯DA)y'/-Vn+~iϿF,Vl+[IIU(E ACakZ֕PQTkT3&&K~gFr]^l*M:\mMw" izo}aZ]cnwMRT/[5%$A>OnmSUS%g6>V 3cjƐV@GB@ˣx/|IXW *XjIm%ԤvHL?:3jDy!?MpdC+J]&L0NQ?%=ׄYvE% 4Sӄ*}/mE"ai]`CijiI$#"1W[>z) zϹyt7]S6(0Z$p:K剨A2cm<)T(MG',Rj\"HW"Y8WIR:lZa)R@Œ‘$(-pړBV@I㢑n#c^9=s`aLg>u=\p e=b8P`\q'RЄG^M DvI51o>] "v I}gޛM+A*$$)󸮶-֥E;!J1N:}ڜ %HD¹#J~Ѐ?rޤ*I J۾i2 $0)(K+a~l:)Dq$Tj-(*#no¹J׸ RR#;H4#x˪p+T n9LnšXUZҰbt Gƻsw6^OJWgl1mcB%@<{GiR*D~_ Fˆ!zJv ۙ}]/"o4cCaL(M-iG#JFަFnG,JN&7  POJ~ >4l{OŲ-ւJ=qBEej܍%i ب` yU#j +q(QHiԓ TB7)p@1os~ H`EZBҞNN; b)b l·"RA~ 'Axc%i C;'c{Ts΅2~)j k:V p{ƁkDx>PQґI=Cl+L7 HVIPA ySFR_4DEZ" p-C,դL5l:bP$C,HHډn"F< -?%RZAPy;D'9*yCVl6 ,~e2X|U? OzkaU{4%H搜\Ηҽ<' G*' NKPwt,Z0 u~]ǥscO]6>X4{8/KlR8ӪOz$#T6[:\WҤ؝ihDY>j$ԺhKUbwT }q$NbĦnv!u;!\Ks?VWB{Ӟrzj܂YJ9zjВ\T ϧi%@Ӗ!/fcdm 6bjԝۂNQ|i|TEXk 1lqXlw0coUކn?' qK B@BdJ:JJ~v# !n> ]'EХ7 $;QuvmaChE+/ܠ[ #cHHp;Ř-ڼ~KKsJF ΡH[m\!MVu ’2 E6I5gV`C.:<-*#f!nJҵ^Q%([FbJ-P n.c͖*YzeDnule}q ;vNnhLS}#A<8{\.5?tA`)DkQ)PDsY<Dzy;^"ag]kD~R2 \)A?f pN#[|5q|ת Y7_ncde4Hqʽki+Zƭ%G8i{k~)|[ɫte%ğݰgj Q-8:TBR$l#`JzP6n^WtsGvUx'ϼÇ)]fYZ*ܐTh$rh_误XwOX}B#c7l%E@ȕ-`ߍC({URJ"d2LfiS\b)D[-=GŚk_(9e_Rb ']ָOUӯ=S|K1J af[RJTPH x@"`v;X Y *)IRޘ;z_-H\,>ΗN H#{#;Y,U8s>_[z3Ai]42.F@HOAjM6u.! T'r H@@ӔFny@AI'@'i#p:É ArJ@Bwq:J]j>׬N z[yRly۬҈rEiҕ.B$DqNX@RԤNۢV 7RXNd=~TpM^*ܨ 빮G-ߴDęVcN8Y.& Rf@A\pիE6X G\;eh)}2D$FԌ8"mZBT7V&H#}}85X>tKPH'ڑ+8rgÖmEP6߮diCM{mI)]HA anVZuiG$bKe  Ix3?}& }@tm,'cEsg QyF i1"{/bJT  &u 0;,8i2)5oj; ͺR眲APդ'oӐK(hm‡!3wbJmO $:IJ㠒":ӳsmfYo=N*s+i֛ 6zMtueÜCIgV|pfdkLSqFRR"Dwj|YmԗlA4pEp`<qLxwuEհI#=iv8a Vt=:S=-}P@2LߊbhJ^$4ݱpP%aui{|݆ԄSuۊ[8}C^@JJfQ|ﭾ!*BCNQM{2}dڒBvH GZe~#qE/OhTceť)k`cPy_:Jo~eO $8L6<~:,q6JL۾ԇ ^y% 'Lo;]BJRg\ţՇ , A R?[z˅Ky M9IC7 q3κ߰*VPO8»IgPU)oZnQX/ HDklXO~1IoZ)o RV oI>"kn7/Ҕ(dKW=n$Rn\ jy` QQ=wPBФL]nbDUǦ݅7aI p Gn).CՀe q6V v HVxVAPZ]Tz;ahloK E&~E]~S\pU\m 8JHꝀ8ߥ%q7hCNhW;UӃGh%2?kR)$OR@;~iB]NHJqJK4VڇڂHiyߍT.$ %+JwKq}Nn@'nO_摣)JKjDwITh6i ޕ8jg؁%6H w~'Kg (OBLzB" )5|؞["ZJ3=&?xEߧ>=#>xnlew\֟, cƬpj$ 1ȩW h)J $ϤAOSۡ !}g0=zA\R60$n&8⻎rl*8bC`(Hp8g7Bc3KWk󽣓LBRؙދD 9íFv1?'D1_a`֘\iH;6$OJ0\kQmd( Y& v1PK+j< RAN+ztrJqDZ `W))A>juIiܵ-b`N w'qGK}$uH>l8Ǫc^&x)\%Ir1Ai)RV+swD0ptjtzsJW*$]f><"X&Is*M^B\KN1D8L GN4hBR<ol V1X%|4ǐ傛WS|Iz%5c Y+61;%|[m ï"հu)K3ɘߵ >Vɣ%Y豘0n7 w ANn8=j8ußO|2$~ؐ@,ک~ܽ?'ٽ {BH)1PGޥXKc>ЦifdɎ'G`AwR#yf*'k|EOi77S~þGmU/Z ͨ$#c9xoN߻݄OI#Jy>=-{,)42!EC'pjhus,O¼Aĕ6JtDڤ]^+,=l+J 4=q,@Cq - <nݩoEz/m"6HMy>CԣP}e}ījO1 mAiCH(ɟQڟǸ L n\wLOsDlQ)W@3Qdlq|ko @M7Nj#BTokus/aOIz9dIP!+Tj&EA?QDw37 ;U=%IPNxG,fnptJerIP#c E,Ljk/!^CRaI@`4u"Ę.xW3C25)R!:IAuWg^zK_F"%[=G_U?Ob /:5BAjd?R)nn!Gq?wUO`ý[\[[ @BԐFF[*Xzex{m?=t5e+'.*N8Q P;Sr7}Ƨ};̍p Z=MX49`!˖|G'_'Q{ϘF_'Bqt7 WmA)pw97DI5IW䭚WII–H?4IEK ?i $ɿQcT!⋆T:+cOCpFo)&uvv{ ZWTΔ5# :nA;z9J 6:c;l8T┷1F/Rրw?iܽ0n/\y(}}%GIA:W@ Uk]VχW9vҡ(uzL` OV~OuKF6&JTNX[O(4rGe)in)*_7-v^8vAT¬ZOv-JL<<qojKZ9{1rͅ%)N}iFuBړ6_, .5=]^a[r `܎G;hC1[>۫)=M)GJPO@cxTuR[~ &}d%B!3`AmϯYcWzK!IAdN'9 ݓBk-pڐ8$8)(ӏcXYJH@NH)qmH$nf5r3'}'BۂJ@I1;:ju3qJ kR V%~R@3=z)9I8uYDG u g6f3#]G-ٸR7-.j*QP@#`P[ @(T m`N?/n2-Mđ)o'ۀ)l8rU${GOa-G?>r'T$#LҸɻ)ʀ*rd4ݩsOSv?74d;ALG]t%v% H$N*ۧ?:[eya-ԗStp-31Wf(nE KB_h tH(xӴMuT$;"#]b.>R pOozw m=d(;r#vLI[+ezgxQJ4Vp'Ԡșߏz~q[᭩eۗ;$. VǹޖΨom+RA$ǵ5ЧqWVSa-':{SlV97~l4괫IFxz mzM4\iBa%$LH)G!;nQSwHII?z5J<1b΅0DnxzAJ|)[QRRHcR f쓰펣 & 7*d!F>;m<Ҫ:lTI ۄJuvV ʆdQ׍7Rq8Id!J$@~RkCtY+.iYKhX;jv:Ρ8‚Yj2Ȍ!ó~-A:X;̞DӮΡ#=eJ.O3"sT*#Z{؟ms8yA3M%?hvuĕ)1wn+\lKcn1w͸ځ$*jk""mi-2 9})l;Kh5}ϧx?Ҧ6 BB܂Dڹ9DtVfmP ߝ⛮ˇÃ(NOiBHy+e`P@: ~T[~ZR $:DDmM#1Zq,\7j-`d+Os@y-o0vTNH'm3SD8^84JH!bF4!lFdASIBL& Wj/c>%vQR m48oRPJ$O~5_Ŝ(ƍJW A~ F0>`v@:z#QL"ke$~|%$*O3́M(mefᦼ@ j%@A'NQHV`Bzܑ2CfBp#;Up[YKknaK0U$p<~~5"}/={Wi-6\ٵv rDK@D#e_nìASūGM5;4uB$ P1aEW[l2LN-A(8ƕ%^\pzx*B*J#BIKi,o>}uʽ>R:pơ~p d>p+/CkN/VQm*Dn> 1bLD￰b GRiG "r6H;nvl(a7jϒ td|u%Fh.-tMrGcw;jbl%pIeJfGE]5jB iS0tO]vsnXJ$L(QOƛV 6XV(VLu%7)2 w vvWi-ҢF(pGQbܺ~ڑŊt^ |JmlR:W^"g؍Sꦸ !Xt(rPRc#SDq cBP#m3?p . RUʣq \ 7J?mCPIV?-Z:m#RI)͈7fݺ|+_B5Djk68_o(FG-RNpkJwӸ3Dmk;}Q2) $ iChQ i4Jj{nL +"uI :V7FU8L D  '޸C`wR}΢OHMaM`'dOG ͛PB#IOݷҵ}# UƽxcN' -#ڠ(}+Io ʙ/.6+RwN ;ۀE,l`£2ƖCX-[WBV u3mIgn.^ -ˆN*U1A:jȭXn maGBP})OxR]J9f%v`ڷh7lZ!mwNޟrO?x,ya`IAMRPw e kp;CſMS 4vQGܒeo-֕+qgi4ΡN`\ +:TvmFLR$N6Sݿ5 p#a$v1օ\-Ēj$~z BK/7J*)A:B:f'vq6Cf'VKIRV=4{ҩ{;,FՎzOna`u~yGKgi}ߖ@hNzDn|&Gia) 'y 쇬UQd[cs gvT橐@I너siwI,Uglv.|nHGHfpwYbR[D9O:e 7'4i%N!jRlBS!zI1v\5on\:][LKn,~Q#@iI&*QPݲ-lX!#Jv2nZ"NCV*4'mhTq̾3aF_m^RP1Eêm7+ mK7YH3ޭ.妊'$@ 9g;jcZViBunF$ NGN6 lUe&Qp뭶AkdI;{[l{8}×R:5,A>YA'McTy&yɰe O,:ȅWtɷ21QW!22Jt•>9bAp|x]Knƣ":G(;0ea%lΦJwLDv.+Pw̯.\j-A?l8\@[ꍌ9r PKZ["IB%-޲Q }zT(J:Z0v#+-`)cT=|+p!eeZ4; fI)clL 9lIC֕Gubߥ̂v۪z6bS,f|R郆^ٯ,D:TBJ& ;veUoo)m ZiԤ U O>VjdbrF.)i-J;v- ]pW..nijq2`jTLG~(eaIy!"z;bE% G.JHNJdOa=ԭ #wEۭē ()_MiRt+vaڹNV8@?`M"l|HeHIP~zup֋6n=-)?DL+g{`Rj5Yܔkz]'Z<) Fk`~;ӆ)-84}IJKH [+TLv-_2Tmo]DqI&8 !İ d ?Oߵ&qrWBM R7m^ L5-*Gs0{JC[8šTBG&7 ATIRP+RdJ&IhQcՅ36 '#>4XnÒ$COon4uikCˊ*!SG :͈o^"Ky͕#~ǡ9@kc y!ZF(@qX4nKL%2~@6hJu%Fl8 *ȮqKbY&1I** 3am'Y;~it#VB[m@ 0i$u-RSn[" ߊJGX޴aҴȒFޛbqdt"|¨bm]{7҅>S]g.S l&ƻS: udJ ";Z]GQ?pøs`[u.ґ &c6bR_IJ qTm8\LȒ$8Oj(Pp$o \qT O$I矈g ˼u O6ߠ邞.+W?8Tp)!!:13=vax){ӨAJTPD SNUp!3 tǰG]8ks)=i;Emн ;I!AI?9@K9Y$T"Ft\CeT;èNr- iЂT/t8 c\md,6L%[m?gP[\\DR?ѽ4Q[^9~q/8ws$WGH{ӻ [Ð%Dl#}~>tuR= 8 *JIOV6 ZJJF3üvR/A[@IR/ :%!ha@-c?E;ekv;vz^49q,Z Rێ i51/Q<USlAkAp)=Gt_:b1fc߽rBJ3JTGI??p5 `i9/" @&2y/H^ )QQ~4YsbЩ $R$(8D@SeI0àkqfҼ0tH@Ԑ@?h..R< = W]FaVqk%1w1jm {Ki.Ԭ ǙӕpÖm(q$܎@!֖!IB0mu]ͶF KFO=+8oT J72ID nG<7~0Ljg`w;S+*)aHT2fx- k6'Kq*'i56.jAL$iYH4qhC7 RG>T{(q6ZUJ DƴL(lF&#zy]nՆڷLę3Ԟ䐕Bc-nC-PK0KBcsx (5w A(O;Ԏ,f$VXMKˮAP%'=E vr*ih#Lõ-#ñǰF~y-ѴLLJ]J>uo]bAcyi 3sl])BӠ%*QXP#Ilb*oV1;mXO^m)@QPx$ ;&4/m[S befEaDb Orw(umֶqd@%䤪Wo»; C:!+'i ? Wާ!}7jXS@p%F%)Ҹ4 Z>EmkgH*Ji"~EcVLV|0טmR2ج,4ɝSs{ߑty0&e'kX5ć50<^ jUoiڸ"N5:Zp2y]K mjJR'Zy G̴ )M^j{Qt27pRLIߑ߾Mw'i;:DI :ISwԒM# eE\jOl$Iי8~fj+S()`&w}9G3 LFlTH7mֆJ㠯Q=VD@ڐ+{;ui pjT:I$m+uė&#XHZcQc:!'~VΡŲil9Oa=*gP(/I'_zn-Sj\qlz 3-B" aN(ll@V'X@;z48$-$6b "#GPTaQ3oZ0mjI$ILS|Xtm--dq;n7xYM"|n}R$(HdHX{wSZTN1_"QjԂ$A;oJ ͥt4  Ԡ`I#MTu V.!R^wj:eң=$[hr_K89kRFIҔBUyT"?\Sip+ zA؂rShj`A)XvU}tc\`\A  h~X $Hny|)tGp6ttJ=2gO~{F5z/2g֥xƹ[\l N),L$@vطCs*<4I=5L#GY봕bd$?n$A_4p9ըg}Wuee*`d/[I"wF”Aٶ+BFޅ v8Fܤ=&w @wNuȳiPH?Eu>y* )\7zoIQj|Ҩbey$93H, yMVG#msh;P5l09D~]K: [2Nj?9/[?CV~Sj:1qq `?*Z\uCIRI=qXxԑ椔ɔ;s q5l<q@)K rJBGiGu")JRe@ﲻGQkשqN ' ݥR^Q%@ϸLr㬅(jBH]ȇf[JIVc)HGΗOXbi}4VJBĘcz҈sV$2RIKSel(MI |Doq#ҽ@:d&c})rid8,o}溎=]\< ^FvW1Dbmҵ4znTZԘ:b0#7Q„7$% "TDlv{wTN^Hoq`!2t9+B.v46e\}»]=nB*J[Kb>[\؃?\MhX7?4yjjRkCA@6D؎w Aۚ+@+a!IVT!@^Jy6nHw3O+3ӈmiyHJ쿉Jzjy8trpe*Rb3v]9Xd=+R>ӊԵ>%>w 9*%/]K%$][-ĉKH%-zcS)طYmj).O3Ahp;,D _8JTOJզ`HkW=Z^-w)uVЭ(;KG2:ݭAG- $O h)${)+b6ʸZT=l58peDb/7`LyqMm9KahNbDH&Q*$ {OttR`E[ۖ%\,IQ6QOS^i9mm[uoC-Y&)2(r0zu؎ۗQrn^}m%q$4"FLI7o}N @% { IPYŲM"Geni[U&TSI;{R(l._c߸eR۲JRC .->LG-fa61Ip)涔%atkX=$F;E>X_Ga)aۋQ7'2{Kf{d: u% :II'jzmd1[)M[WF܅*1O[+Ý-ϵa)!JԇAӴU,#ʇ"ǫonA$;#RDo2*S _.>k~+ͧlT!@c:JJ`zɋ\i[Edž ViKa n|$)0L(\'4Y1)儡uA+}bJSH;j?ŀd9B6;QMgKL zyYYjw=84Gd\lf[ ġWn'҆}N'߽A''_/rAVbk|immP'`TLGb'2)//w>IE"?ԭWj1A5ۂsk^1, 'ފPLSG lӮ4& G!$q?VL;7Se)-$+T$bx9Pƕ)Ʋgx])ҐT%IO_\߯nqq)ZHD'O;GpIaH[7=SBhn IT4D A6LfةAQ;uڜ}XR"RZJwnD|LP*h)>^vNHKN@RP7Px`kV(#H3VyihF`$UwJAғ>l2#;k??kТ%ůu@ 4ba6R?;wD;=K0;I~ xHP>X$nD$V^b@姐J0 ̅u— B?$Z[& BS3 EQGqIBB`}ptJ-o Zv!gS>D|@4QX!$P jѨ_ hŴHHu4m&cy{!)q! Ų|i6M##f\ZVSH@Ө- Q ի 9Wu7r:BIdqKVЗ( Q VRj99uIY-C~@y@7jG$bȵ)D2ZWo= 7]gX38mHV%bHH*LuӍ6܀PF }; n6KbK> -%[~1X:?qrt^rF-'u4479l=*Jųju[v2vq$u+SN`JJG}&OT:*L J) K;M4[]P)Х*4:DHlJ Z) ^'R'gvaw J7_HAGm4ĥR E% ,JX0 G$wm>Զu ūG@qJA3Ǽ ޸J?Xk }[`owMҎLeԬ$* ZBdg~~tz;eu"ZQ=zrߑhk%% dkHx$Mu.#HI$)]>bc\s:>JB~+=vKBr:+)\[(e:(v_' ;GK 2%wH$RyW(q(⼱w\iYߡNH,\!7IN!ZH=$c񥳨NX5%Fw wm 4BٻL<:|ISP;ASmXQհaKtuXe68[BGH=QM-KR @hBm2)IgB7X@K8L:R#>t![ǃ?=Gˌ*[K֠R@!2x:F݇]BC .A ߪ>E.T#ZJIBT$n'av]gwn%.)2G]3āS Gmi4:{@=xмK)qL-S@3*#i8jųsFu Q@ My=[ۼ\§P{zRmP@pA#W4!(KO8ᓹ($ޑ u-H yj%FVL{Drt% _ e@ I8mN=Ĥ-dKOX)+uyZZP'?UǓal*$c!DGiNb'[dw=%!' u-~ي~8 T%M-!{~@QAWB⹤8k.ambJ z68u1 ҎJ}>A4lbx{ z]#껻% *Vms ?Z]H=Z Jw@۴\R:ϔ@S&#GI.6i G CWR] B t29?;’9tہBdƒOΙ8\疥zP" &L{sjh#tQv]پ,#oI!E؝$'=TД'8ТILPwMֿ- -ml$-s[WY)o|8>[4PVJ-RX*O >'}0˒ƴ,2I;W}Üit=ɟґD!iAn_q':iZKJBN)nu[50ڧy3sE^9$|G46q4:-iT)K% ΒwW5g l!kIHLm\B'm't&TRz?PwYQZ[m>ZX=]+;ڄաS[~k=5 *L=7M6~qn\>J`V VpIlԎFt':UvaISHQ$rH"˧S\u׭*vO=$Jְ.Jr%S I5-}ZBN6a4(Q9wR[CqE;d{G&FDeE07ҸRy:Hp˶V7ZTsNY#;9J[2!" ҁָ㓦!STy|u'qyN6Xnn-P jPVO<&=[ԩ78qFmsoU(O A4qc,awYI <+&)!,-I)Di߼OSSblE8U\e @J`̫LE'禐RcxK)((H`G v]C:rȼlJ‚P`@'h{6XNKI8TF+9ٻX6ܗA)ҹP'Tn y'cOIH@RL{۝$vWkp.yjI`#pIF%kLte ۰4HV>pkĺVAOIh TKr,Ү脫b֮^ᷩZqIBΠƕiT lA׊Intr&?)hRZdJgr(QӟL؞j!K.omUKBԍ @@Ih T룵#yoAs~*mP$j.zb?&$sޤE}>ԲCrxkrD(*QHI27*ItJm%;KrkC5h ̩A:RՏ}C"c3b7mw4!m(@.~[@u'oGEYxqrT5 䔑zڝu3d/K7kme>bVTۂԞC|P7Ԕ? &'MBF=gDc2xNJ#}jq, Ҥ'~Y o+MiC[ 8`JפmM]!:D;G~:e!IJ)N {oND-ߧaeOy\5)d;ʑ>iOȖVv:gC{Fl Z©(&w]2;3^n]Ru&U$)3 eǐ[RxIc•a_av5Z6]-eBc FƥQ_aՉ}Z$u؏Q lw7M>RF&gVqBgq5))>BTSj F4u6hyn<IO"ÉYň&ڥypVLnI$59, 'V {m ֝A"Z )  (Lo2H)9ŋm:[qJZH&ݣ"{P$`yHqAW^L~vN3غTVR!i3"ITGYmMhsիTNrN%[5 ); "ѻ?-\"IGAۚrCL-BBLS uJ72Gĉn8=8C$$BU#r8{&Nnn o6cDi LZ86M$!I *&xFqI *{Z$#~p5 ƾ*p FFWXAkۋ|0$m976%lJ!I)B`1 ǡwZZ$#d') 45n_$&~`ʱNx5C4q@ҘҝigٹClG紐" &Xlir;V" W.CGo%:^hTG}}NltϘP!BIc#wQw7?p %#}i=I>*:5mC%K.D'T$u RٜY0[YS$'b=*>whZ֗ JJ/~)XaŁlR\VZZ@H0F#u+KW6 ֓R8=RG=넲9ul1Mĥ.E)A(NA3Hأ+o[0t#^iT29G1\6S7 [ [j0HIQo)7;b8.[I@J'az:\ڿq6R2CQr ovKN2QmAI_D qd؄+||b%1HXLnapiwJp5~T$& ? - s/ۗLjLeIAɉ0zq~js}ZW2`GMڑ CYۅkDn ۩kn,[LE[%)ؤ44#Zօ F܏cqIF""9#޹}N\֔ j$m2eBI)h㟐$ S<$@DjsGeRx "Opi*ZaWt-F;~r:8jRnw߈uwZS.h$}.C^OH&;=ϮHUB)3wJMY60T7$W=g (or7÷nwW~ y ytŝcl *Zߧ}M"XJ:ORw"ڝ𖙍HI{ZpmcRАw|dOϦԺE-j)JV$ȏǓkCx{LSpy#~v9Q!0N8Cfҗt%]!2#wЎ vVh Ic8h(B[w=`H=X%JTI ~k8RJ쭸$i x-ڸܧDQQ!$NvH20gBtu~7W$v,༭(V4GH5ZaXMKI$=#j](;<ݖD#_zZqBt")(J߹}Ga1p{a,”I uޛIyFԥJ*iNK mJDGIĀ *7-0R'XTqNQBعm2J$$OBMSK>&wk ; dSꍏKt!sJoV~q@&9y:Zt}%ߩץpa%1;GjBOɏ=p ImAHdc]#0IBB7ۙ&~14N?v=~4c[x|iB3shݫ:6$?}2Qc,MFlkNZu})G$'|(Z%ժ:$qPqZ;*ABiPD w4ۣ[QJ$ºI3S8X02U##jSd\ED GA)Tu®[ BG;<<ȴ7 |Nfp06SKO>|fD :[ےDGMQ;mb9W])Yi?4U;/s=G[gr Cm%e %-}ԩؤ 6ؼS.[eˋJY:KgZ"AJ`#~ ي-:U,+tBx3n'ӓXЭ*I )KH;Q&cX[\!/zWDLDMQBнer ؍]֗Mpc(k$Z&BWLmIuJZ\GL:mr%.lO<|HPNˎ/F+mK(Kr!AGa(@`4r.Ngq3 "CTBooeVBPOXjˬJD RvX >pqD(N{ k95{nPP, AL|rvޒ$ fVی>Dґ3%@gœ^#ܭ)(:PԒ:j6߱QoqRv gIҝ8GmbH.nDCgRLdAÙ$6,C0bզe_eBe o4#eO}jJtJH>;{ ΍6UzY JPʜoW)Ccd#h-wro[tekk{VJ[tOmm"vrZU<}m}! $ҭ?f6#Ȏ=?[|jT(ZI"ΧȔZMa<L&t+s A< i B@3YnroJI )?]*HN a"RRƀ#nօ[Ȇ҆ϤǓ={u֗sr'oEQܘUJs;ww;l`o"BL^>>T:>¬lmXXJNI3Ƀ6:ӖXGp{- So4Li+cs>9J=5~d\!{(E`WuӃR,]l{wJV҄O1&~=O65vGw?&>Ry)KOr~G?.2)WՊ7F#u9LEe^?!GIu0 @;FΨV#;ڿpq}d|rFëCc+6ןݏTGA#hpX-7stTtw07jg y7ޜQ_CAJI\ No :Q˿Uj4TG=Wb_̛.p`H~6{qo(BPl y޳; 8iNIF ;)4«K[K).yθL'#)[jr_3Io JIHHk@q' 2 0RuWp-:X,\;X1NUX\lpR$LAJ:ĮbjSJE}B> fA Zln;vB"P6%J=[[-M CdA?ԩcTDaAS+@ <x::;rgXTFטJΡ^D8ҲCIH ܝ߿^LZu:tFP= n+1y-VUA *168#8XmޅI ]'zc΢)>AC07| ?&LoH]u! 2u%*$&b5pzS's q-JJ7#}115Bؑyb-ei'qd]$L 5T'“jo<ޥƤڑc|#N#mZUO!;IIޝGabvS0TLGRCRשyV앥#Rϡ{cȍb=VTd}51v1דI?5q떿:YP%)@LK=3;ê)YRa@mcjQFsóipBQAF"V BRqIJq%@q j'Nr:a*AQ:3w#ŶSw KJZ:I/О@wodޛuy.-%dy:'XC*}*ԥ$i§}D]Kɼ`0A$y>¹D[9y5BL0 )Di#Y:zuoIGYŬQ.GBr !AN"gmW#٣i~`K^~`Dt#jNE[VuAǁ!=@ZF E&n,:T4Ip{NgaKIq'Q%PIIBz5[7-9+ :L{l0 uW ڸ=;E%XlӣpDKMIE*nr$6 IvƎťHg[ai*Lduq\vVnTF%\$vH6`\JBJ "8w"yjq/ @RPQ:mSJMQr(TJS:@Jͯ԰<>= t[pwcu`@l6ـ3:icKc^H )$HRLIv?5p֔@~R'8fıG^Z*{&8:+sq)XꔹAru"^%%3x+$f+፼\yiqR5TD>jf[+vrڶWb@Vw%°jxa v2D~1Z텣fkeJdyշQ#k/0[t֝ H1xBUH !nFHoi(u &R@S3 H*f9ڒ<ݰ]ܺ PwʺΣ6AƝ%dDa'cT"i,qW 0 wEWW]p^&ZZ}8 ,h]1S25' v8d{Gs?RrpL8kbОShp8ځ1b}딄iВz &&;=E:Σ1Ʈ?pLGFGj1(r^2֒^DTǷzvsGwG 2GsNԄg]! %'rB~]Σź\[LLSQÝ/R^i+W@`+ G^[JRH۝FdFC% ךP*P~sH 45[BI;Q#ۮB/o([h#RR,ߒ [bᷖ]뮓PDB-0u`zOBL~u8!- HٰS>ij<9?2PIXssa=jhuA)ԘJwf}G;It'O$Y)#s Y:"DRRwmJ'WS >>ԛ7:pT6S4 u|ւʑlw{Ru7om25!GJӛ-G[\i $UKPCE$%rFO~5Y‹l!I:D&fH=ԚE|BCbBL$u>w'V2iA Uu,y ۶õH 9]z-M @:L=gP|wYViۅ1Mvn} yG1rۅ V$A` 9;B[NfTve <;AlZ< g̷r HON)RoRԗA@BtvIGʺJiNzJH* ;nI:}b%vRtNǻ4ҔÎNҹQ&PD H0xX) ?ᙡZIm|+/`g"uA s;\EJЦ#n9:j'UJT?T%(>l@: F6'Z!:cǵ.6pR[O`T$F~N*uyrْJ6$ѵPd6A*m {V[`Jf@XH1ƣ$/]8ۙK"OIRސ(op)iyp5i?HIu (JЅ)(Ht֕OW]3;"8RЯJ$O@5;ܜTcTe1b;(xhwX_,.{l>uڑa6PHpȃzr^2JJ2Tc |uvF%dQ3N$?ڑ? -XSIp=夈HT= ږX~ +:5y 3ɮXB*Ido>*81o0w 3ԫm)i cݥ) +2I ;Gs'eũI*$ z&bg %Er8AAk֚В'(IOxڒ 5m+i(ïN4:mJ"SJ<ۤT RFFdo@ QI;AWiX/(Uҕ-'yHV8 A1z8,)e+H+PJJwV])z"AX-!`"&;mBeDB192;R}uNh-I KM=N$&i53f)uN.o{ H_12;],wNTb9gkO,KGVЂ`g6ܒ.O0kR)+;RAT}/؞Q"ݐiZHm @`v4(J.1 Sdb6$Nc.XcC!)  w"bKYqN$Ԓ㐔oHj]"-c K-Յ,cpiN#ح  RtPL{WX[uHIGZ(ōp|/RAO 'ɍKαt)FFm+Qr,f֥ *Ԡ<Iuǘ6pR܉i$jbzA'=1[m 8BZ 'ʐBJujR% Žr>- mcRVӰQI ВGޚ;wJ`%I x+HWq|oÓ7Em˺VH ~ XglͲ^}\+qjZ8C{7$ >jFöخa- vߩI؍JoJfm?OLCj)[NJBΝ}3NH S7s# cK)kbNӨ)L[8~ Yq+ ^"uH3v*QlPWI7E;IW^Av޸CjeJ AhRA#nzIO5ɜ(EiJQ ߩNpqBA %~>dg~B:$O@DL$ikuwPJajP0c7)ORYȑFLiZʉ @۪"g{wYY>fďj ΡS!~su⤒7;l *$}ԧPڸӅ(qmN' &~ġrAhe1sڐ8:vR7SqNZA0ui_(߀x$tQeͶeԓ!@*: R2]b&.]6XQi,A .Z%aGQJT@'H!ٯ:a3a Ď jb޴iBL()H$2{RI3C'鲴B-%GiPT{'jQNWJhO); `D'bp9?q8T3߽-1l@pZ+YR@'XR3?#>W4E0徵~ TGIpz 's Y+id@;F8J z!\C0ǿ`=[I:Ƶ-$:**P㰟(kt &VD0=ޜ'u a-ReNLjv7J-8fbVhAI :½$sӒBi! 'Bcӭ!,$!v#vأ]$lA$$uG))B[զ~ItskuÃj mw z8o7M6δJ  hJ5@<m+fSHpjT'*~(k-(RSuGZQOPVB8LH1'p7@;&([f#RwWDGxoŜ\%^^!ZZIFNJV"95j JK'W"wLjZ \?hw%Gp&&*Zґ6r.B;H?Fy8Q:ؔ: Kt!AJJF'R:gq/3҇:@A$L6>wG0=U>w*TMq"嵥͇TY@)"(߁ӔlA@aO$!HL-)@sJb1m!N6AAO=S)ųە\ }f@3OJzU]J&=v3]K d!02H> ?14umV6PUARA?8Ibqb$oY ) :^mSlڥzWpVIRLG"\TR[rD:z9jA +kœee({v+8%’իI"Ht38W ~My~S*BOJuI zR33`~M}XmD&xDhj~2|@iDr@_" )ܨ.eiIZ*XHG#}AzqLIl%E:zdDv5)iD- l[ִ6QgI*q+nPXTR]RTRJLS]ȂZ ! R!P) &)ݦUbS̼!&uvR䟔t7Vj- ۂp[kjPJHv{vKm2ACɟ(L\)dUiI% G'I}JACҏ1 4? Y†0-қ&D uz ~ϥj)$O#[*M8T ױ0ۿZQNiK%Ǵ8A W1:԰ U ʊgnBy\!T:*qUeDzJN9)-QF~2ipgR PJ Il2}c-a@JF$0}=ؖvs/ܕ.%*HE;3\\~'QVXЗJJ)l &F q7X}!I A#S:(L#XZFqRP5QR':9u|zE-GM- 8NLO)V#xg#za~R:+K* n&I'? k‘e>N R% ~؍7AzђnZ@ߘi xq<0xD G~Gu7%V8}UpD\ }uSu{QiIo(N#]bЩ;Q Rx ێ>4֬"%cmjiw">ڣRv20OI&w4uX]GLHz=ۯ[p#{8\vk Ԓ@+T{@:]GQvԀu7IGPwLMRd8$2~Om |)6m.v\ 6l-25y㟕p82nAH(aCh5ܜ_JL(v$mHqvmRlQ ;KB ֪Q$ˉnHv}q?+ 6gq޹;J19x !B~}4DU 4$#ZZq +1k9&T56H0nSۨ;LmQD vtժDRt u<{ԛ1(MsP%%h ȉښ=Z& DA)+vBVj$tbnSL!)XԐJ4ӄ۰K3ǤÁ48u*zn P0>qOAķn< )@yF8hsL0$(&9?yidwkC RH؅"dRig#̶ꓩKePjs?m- dSsRXҠDǫm @Ӕ%oۆ_FԅJBD"7(#qH*P][aJ4#e ?^Vݦegae*q K(Q-@Pw֋SBeIJOT oڥS(iʄ;RkGzаH+ ̞"nΤvwC$JN@AvF6l:T xokpKkBT)1m!]j]Tulm9K P)Ltƴu{yh+Р zm>bQEK3)%))Lz("\mW`Ϻ\qsR5-[zD:N8.Kiy)llzO$"q,Icayv[qDjhRBw!@P8b us$(u? )fCA:?8?8't[nf2vN I DA"`dyqy=ܗotݼ<\AԠRT,V?Ȫ,}|CS{ ;n+b[ uµa R5@Gy4K!!puHwEsr5P#XDo?)9b/<̒RxOS[:o1 j$(B W ;@lQkWڶ)d6I܎6Ӯ7řIBV n ԓDkaRHOR} r9 [N.MJҰI+05@QGn룈Xb[#YZfNjHpPqT[I+R`I(̏p+wTbv.8;{!22ZP㍦$̉ .(u8`JI GgTRFF㡘ZvHB&Q}̟ԺtFԍ/S)vPqCkXG@xq$>ZJxHD~[\ܸ >Q -L}ǠڒǦ-YI)R ?DȈ|4gyhd TB8?i% 'D§x3c]T8{6%cԅipL>ӿ;[.M`*60mۊ)8RVܿn!)uA#"V{c.,ۡ"BLlA+ GθG{^8<ΔzybI>tl (24G&lbyl`XQqKB;t"4) BPIđƢ8旁(hr ğTܸT{r$M~SUhpkbɦ!>vB;NBlgKkZHZaŠH GTv7q%T !:` L]G6FVmĨ*M- g۞Z ԝd%.1Eܡ..\A*G"4$clj[)BB Q;b;ݼyRZTKT Hi'[pb ;ʹ >ۊV-GyDBH%)JJx2RuL?iR ( 'x񥣎V- $̤ܒԩWs%Xf(u/6J1c;a\!v {S!HLCM82?\,8R2fTHq“: SnЇ'lK"su} JՓr@A(*hQGIo}C uKJv;=WC[;h5y:}-ensQZ+% A#@j"`&m3ڻOV7k"YӰ&ABqxn} Y%E;=v4G R  9W]{H'VoC+: :|+AsZC&DRW;6X#f_ٗ.m]Ӯp@IK%>:#"`å$ aiJ^QdD  &#^s*=8q:VRJ:*8I&fg&Fqv^ޭe~Ar+"7 bd]^f{ǒ奐*l!*my} EIJ{8mKeQ}+j>OQXg"9wm/ } +*v@OaE$n9AF94`HԈ}Z:[쐛&[uZ8Sብ6}-!*IRcp&;uƤN4{[0Ii ܪ#oǭr =e: cj7RT4$thxBQ˾ M FКX=IBӲ`*]iѥcVI\y RI?VQnȳX˗kZ\C )(wIRߤMbP|.N:n+wrKmũhF64 ;ITs8m)o$ o^TrEs~ 0fJGFҀ I#xC+o͒P;HNJ!ηz\G:E95[ݦ QH.#i>Ī=4!ĸ)P$iێ7}/jp*^p P;q1 "+\2IJH|zgr#b#b;\؂h8Q)㔝O~8+jMor1 yFS7O60 ^Rȉ sϱ*W]*JT$q*$ os奠Ҋ R$}N C;ilP#LL$Oݾ[jJͥzHTRyIt*6"wpp 0`Oq8hyH+L= s4T{zբrX܏cWPbRR$$lM&;|UUOJO6&$L{S#:}q9Z m4wivBӤ N%!m̶*4Jԡ=C_"Z4]t$Η0~jB&{^Z]Bq xcL^k;SZYXZ81tHU'j\az`Q<:+fR%H}: $~u gDhGX~yS#'ӕ<36R㇪cy~F!Ͷp)DĐ@PtG'a=+ H_!)"R@=ϥ"~{s\ݜ%^,SZ8e>[B 1? e&N#rj)ZvCvJ\mmO `1qfJm'):O1Sޕ3bڥJ%*I$TD:}.8Uu^|ཇ(DldF|j8~ؖtD =+>󆗰4A[TSx=~\+GY*)A@Ўθv; (?AԱG7g[ +ۭ f>ou,hB7*J?#Ȯ#cRLR$䝣w ]'YT@^ǧZGl[1sz!a?$w4:֎%ee! Rs*4TfU zu.Xݷ,&G0`u؎OSA0Fap*}zNvZ J$)D8vd`>_*d93XmӀ/t)$ pw8Qg|P95.B&mո  }+tKu<A@ q۟ps(Tcc*N D8AI$f}$M':hVJ ۴Vm R%%7a0U8? ?a,~p>sr5"7 sO)Rd 6::ɉC~=;%2yOI֐͜mZP!>·w% Hw~jomԦ`U:vëpIRtF|kNJP+&Nҙ;ӨzgM4]J 4%J D'qS-ۺan Lpz:[L߂ w&yL{OICyzةBI(e*s$+m&$6HQ=~zKg'$ 3as8d lʗ)"C`Aߙ'vh GJƯ-R>P;6Zm3qj:-@ aS曺;cpM64-s;:k nە$֒䔅iQԬ[/ r m KՍ?F}$j٣jۉ-J pzm;SRg6uFޢ DrO"Hzp3NQ,KZ^ER% = I)-(VֹL£O#jD$j~#qQ?I-i V';ڔyUN;[DiJ@Hḿڛ=8ReSa%[IcRS:X_Z۫VU!Iz' a9rN)r l$2H'tR;8g>BYW}$CӝN?%(ˍ9v2K-lA*J#mc6Tq\* @FLz3ӚpiRJ]k$iX) pP $M([3pS$+AT8xQ%yiq06LsJoº8ܮZ{TCO:~A˯IBZT$2'7V =)H@3Ē9'LX.;lXiQ2XAHR o»P2B*RHv 儺Vn  POr4)3cbl-Z e &DGoV:|%k@:&>Asn-*D e35?=J ҅1D$*Vδ@8'Ԥ{yNۍ%G4R_*Ql)uJLcm;*V"sҹ3{RYɟP6JUE*zLl[ϸP Jn xl&w*L[0g:OIH-LCO幩\)U;j^G n>ֆFQY$BGAtqe qz^@)1S;yJ(?bZRHo*L΢<gF7) ИQCQۉ?(RYPm-%@U6;w~PCN[D'ZS1A']Y]K*۬ p6<*]lnaYN,A[ >0Auw&7mi!{+Gq z+RRO脤LdԳ.L˸kn64,:@ 7rM N.xJ M@)'ҏL e\vGQk `ˆH4ꑿIOXJxs,듮:* zLjW)q,RF XRB'?gK!~ Dy>5:!*n!8RwH#1cז q$Гu&uش+q^\di6t4[J-RL,U΢#pϖ†wKζ %y uhU`!rk\1xJdNlF$rٟ'B]ID Aq0 'e LwO Z8㉪ l53U)$?dtk+[f*}3HjJ n.Z a Le$$LGtC'JDA$̨k[l_|HN;HbT(i !H( $(W Q۳HN% ~܉4w"hޅ9渲@H=;N8.$GHgmbI5A*IRRU &AOJHn'YXsiQv,Tӌ)zYVN(TZyT&6LtGq0i,S}n!DA;p`Op½kq,A F:63#g-TX_\߭rl #%"w;uv{!X(m!$Icq'o*7 c[T)$+>3ۚo.y}\i )$IJTHJ%HQ ~rutB[ #b ym&G=Gz~my$i&R7OvcLTk uOv]X7)H$>o>KHK R85A"[;n9ZJgY T  v=ı.$@T!%J* V퉇#Q:*0gnzRiB諫{4`-BDOniBNt$ J%;I֕1,s+ͷRB wz8m̯:3$"Ovqoqd R@禓Ӷ!hpH_0>vnO-B;.չ7׭#bεnv'sNԏs:S XQc6Li+]j%e% =#}qJ:7imt]jň lC$Ach>4 bn'JۮԴuU!E0>߮''FBJRZ(Δ3[5j1eJ$lx?@lFm TIPp(j@"bL;Y"~nAy=&~史xIRN4nZm>B'L] rEʉT_ Ios]ʔkRN Hzj!Ճf5#tOv<=l$)  =RLt;өgJ<'ܞN봝bVn¦Ԕ T}J V4R2&jKo()sH$$OOqH{@4-zJI>S[*BǫW3pwnmI +'oͅBmvODZTI7T{Gsģ7k ԨLB{Hߞ,1g+ t9L@Rq Bd&QǶq%)嶵A%*qG&:.7 )0T'']Z[]+lj:n:iUxK_)Q;8mZhSM\\ip m\ 7 _?e0dΜ 4Î4-Ŷ F 2c:u4lf;{Ɩ:.qI+t/mGutyjQgoe1l'olMáKA H*Wi%y\V&Z b܆$w~~TƳ HJB?zM :7]mv m3tLw"OϝWjRPZTfv'v3J܏, W54P3@Or^2ҊAtWpp̶fHh(mwW\!Bf4UH9~15qZS{Nm򮳨tUʒ~HZ0[KJ;zVҐnD%j;Az틼-6ZPW8v \pp2}^ ܐ LWYg(v)J$Hum?1Ҧ 1$B@H{D:9v yߟQ/V曅4tU$N㟄#c:%+.FA@9=Em+mITm!$?)j!n6$ QAH[i 'U D)Z XF2?_:JbID!;sQEw̤ݪؠ w G9Hب0:iCi \oRdlAcۿHuo޻p%#d$Hhpm!Ԑ7x"Յ.a*[TV$N=+%arCD@T$u$ޕ!޶|JAN'dOڵevh:iP7:$7tiFLn m“H1oofTQA2e!> fIƖ8z¬mMR&itzL*[AD5 {v'~T5p!-0j*OMR-؇ŗS)$yAzȞ64p:dϙwiLu؜hOjҒQ<)RƛA|IXJ@R@:>t],W PBS#ڕ*8*]\[mRJPLs{SڣXcL8[JժO;<)G SZœR@;?kF)jCkJPR~$I ę! 9=Ju>pЋlB{/Pn>c)օ֑nR\BVR?V#Q}/';K<-!w%^R[ 2>֢b#}뮐7.l|[-EDv2OzG 6y]jj  £t2>[K L{E7Ch%H*f p)9i5YQJ_qtSm%?kHT zTQ..S'tL$NѣL}k(g3tLJm:4l'sw;' M_Zy5HJA%dmԘa~R\m@ڏI 9SpiYi I ԁ(ɤBk7:u0$U\uXrPPV;IN5v1'8Q n/:$&FID +D7`iym+SJ_I^% '\zu;]Á DoxZGSewe DKBD5`'OJU%tom}sv'J!Y o&WfoB'Z:6܍>/-4R.,[Ha(*;HHH]K ׸NNASku n֕;oʈ&>;}=%XSv-]!&AI?V<{yEr.! BJ WC:DGuWםvkJ%@(zq)DV}Ķ˧!>ts4 Jw" _nB܀ΑvI6m B& ߥ#GR[Gt ^AmaPRNB1%:,2) ߬LSs/wW<~4ҧm*TߪIh#"vWj BP8Fn@$*p>QݜtmłIJn:k:! L~YÁx6Rg uSШ߼3!,L 7^yPoD!1w<|)K[)P(JLm޺ضwxF6GZ9rRoFzYpn7H$J{v*˥$%jH) G)^"SAQɜ :I$ z=ThulR-s;sN9;vRB@ ?upra"" #i?=!2Jv:Nǯ$FiNg.vZ}2 ܈GqI9.u풥Rx$#p9ھ߉ .\6^%PO^Lzڜ? SZ w[)yb?\bФiZ\͛R(Zm I3 >ġvd)Z?8cšأk.(2sw}ΛmaO:M2Q(Q4JƇ֟Z}ĸHȏA3ק^dRX)J4Ci$Bc~'].k u 6A~qJ]IB ,Qa:N:,KOQ6RT{0Ɛ;w"M_` HNZH{r< ̄' Q:!F j)b(A e#XTҘQdan+Q*ըt$ `w,%Z.2-Z#r0:7α‹Kp?lԤ;FѼU{b.[%҉#nzRtIrBе,"OwH㫍WO!.'ԒOgUsoȕ8"cb@TGvV/bky u)#c J'vV&<)b$xnVS)R+ H~NN\Z5R HPڹhkuBHW&}pu.BINWd׿jh'S)O$rR}iwqS'z%R$6O|(m琥#PJG2/[ =CJmȈyj݅V!iA'KH#7Tw !,h+[TX;iТ+,ƫϜITKk:'uE6Ƿqh*S@SLHHp玦n\VDFێ /3szm-u)$H}MG-! J$F$҆RB6y>湱b}x ļ(jP +b_eZd-K *Nxni(8u*KpHPե[~8h0P)$rkyF'ai lr¹Ks_hqvi؀p|ؔ5xK,>+@!EiX#ru p-\\-%D >C]0#җ ÚQ)**'}P{IGr{~-edI4)HwM C.Za:gX!<{znZLݵnPSusڅ&q|)~yۦBt Y@QLGI8#qq:;wBbG'TҐέ#Q&`)csh RAPGab!zVe6YTp% "F5ݎs-26JH>:j.tc,Uvie{ AD:%@xڹq0T|LVVLB8(ZqT~} /n Zc`Јba}y %)XG'pgsKZ9b7jRHI;?ӎұ <*B1?MN*q&bdrq5JvǬI)P\U 2]ԇQN 1ڶMJ sLM{ vuVQIBJ m8_Ǥz^u(͛˥1;81KgKZKh 8`yv "GN$GX ʖ۔2=J C[t{xf4vGOe%[\M{Xne$;!Dm4 \ R'h3OHFVŝK$ɤG1Mۭ2Tq yG1-e8T5s}bvSm"@Ru&d{4(mxu v)b dK ְY <5)v>J'iۧoP= AJm 9 t$r(iEQIZ:W!”tww*4У0{\q2gqpZ)+NTG1>% 1b$Rꅹ]R5P$Hu2n;r%2@J@Es_qt@L=Anl:(V*8|c^4RTGLo )s\f֔)^\msQJIfy:4VqMN{[uN{qTxՐkRը(mni#T%bg}ŝ쩤 *?)ӻ G_8xN?r^q@$BWHo|tB+q QChAIq7'mMrqY .ģZu*Q߽=/~vΓRJTr:[\+RA>VE+r+l%)YxvHDm$Ssr y []:THDrWL l88u0dN FzKZ ߪ+T*Kz 3<1;Zا9o¸[;snVI:wZ9ضjrHRGǵ6a%֯Jdz!#L -Y͈uRgL"n-җBR{t8zNJp֧J(7n) m#^I̙;DB^O#\IhK;5<T6+ÚpI `Triam/pFiƎ.Cu@v)ZO9o* N\kKkJVp$!FwmJg#۷P7+Q/uiL&vn#W]()D? UIlS n,cTϺBy$构>Go+AK*ȓh1^WKPzKNI'x>Rϲi~+R2/˪y6$}㘞 bwcx9C,z'<yջup=JH1"jWþ8m--I y Lʚ&IXP!A !$F;2JnBJuӷCuhcZM `Q:BFԕBr8clL/6dզc"VT3QRIPAۧjMBY)p澷BIK8`a#kX[) IqZgbwp],`IWq139+㋥-}663 LB C#P*m`zR'676͕!iRDj[d8<ĸHJzxDE6DFnX 3Å/\Y^_qjd$A$ǵ#:A0&uJ +H:gǚyo`a %BL@=7;(ϰ,l:]:JPdv}k e7жRn;@$]!U4WĪ}SOop[wiN6ƕn>v+3j\F6Qc\ hTԡ5z|D!Ö!(q)*AuEsX-YJO D{}5a]4 S| M*B1M1^J@ 7YSb*(ЖʒCq}Z8\ݛ.3JZB TI$)9#\, ƴ)D9Jٶu"4;I߭w?p0}rʚJ -dΘ[-KEEDfFa-G0dW7cԖЭe$ kտ+*gEI[ u VtL=[9X/:'wHJEYi/0C,`sԙg1CVh$* #{Tu 7)7\$m)75u,$5))Ok*'~M{ ȕoˮTcq=뢵!BE£t Cs۝5YD;G_R48 BҘ)8$>GZ8I-x4 ~5$bɏMZMaRq;Gj `b$GtϦ{iD>mHS*iVE9yu37 תJe\;MH3K} t(PJ@ O;Ip'l.iR&8M }H@F=@LZwVd0$H2#cRC`An s<ƣ{qqpJt}rV{p4\n-A0y`GJI* ]n_uon N) endstream endobj 61 0 obj <> endobj 62 0 obj <> endobj 63 0 obj <>stream Adobed                iC   {!1A"Q2a#BqRb$3 %&'()*456789:CDEFGHIJSTUVWXYZcdefghijrstuvwxyz!1AQaq"2 #$%&'()*3456789:BCDEFGHIJRSTUVWXYZbcdefghijrstuvwxyz ?nȗ;#*.C˷%ڌ:O4QX#e! @nt o ]#He-M;I8G3bSRYt7mb=+N~\T`')66$&hJu.G.{ A1 ߕ牂#%LK (~Q:ܒHj#LY66k߸2T:v -XZFI"Z ,rk)=Tm8:IZ*$鏛2Ca!)"_2UO!IVw}bS5粴@LxBAk_ #]%LӚU5d]4رsĵK#L[MbP< &vRPUU8Sϩ69QI/N,"m7s~[2v2WwYS\Xky]1nl;v642 dO I~CN17TGQgJkUku玳˃R2'Zϵvo-b-LDᩊ1kUOJ֕qFy123x0qgq>՟9NL|&R P6 u,mRK1 \@Y@:ٷ##KL<'+Xj<0WVE4 cf[IR:i%by~ia/TO P7:ʫJ$QE@\6-fNqX+^uh\ w X><=ؓRz`3ZƮuܱ6 =EVs׷iǟWz3xoe6tH=["t\XaHe8Ғ}( 9)UOeV(ۅ~dQ!$0Yå _S|OI*d"1`<# 2jZOkjLLBKR_vJxV*Um#K؏<$u}-]1XSs -ǥu7\Vos2NY(JI~m|Ua-gIr}$b&r3%nbw+SPCX^\<"XN&I FE!H,ygjpNkGIUcHjfKőt98nMKݼUZxd4<\I W R~`i<5ePH4z%:,~ؗmNeQ+%PđTW/.Uf4`qi^hVt빽Փ VzIEŹxxz٭bܞ(@T6H+`u5f7k:+3pX-1jQ?CuqVk~ bY+_@bI<8z%E^g˥b$#s]<XQai ,u]M3UMJ,0d3(+`H%\ P{;QC]C+gM1O[=KDv;`t I2@j@IXhXԤJs-OsT𦩞vUUw8\XaTٔor$-҅[̲RSL3HXT{dK5πbhRĤi ?9N30f;c6A Tcb DZ0[ఐ'`CΛpq+2r(Oc{Pu#@Tu 郞c]W G#%mAlaȟ @F$i[E9Ժ0i2#:|US4 %OTRgܑ$HoZ-ivR8؃ku,#xi`^@t{.]L{6aX)]dB9,6;b3$KQ\u\;7gNBy,H]N]3#`刂 ݝZ4]RQVK=V]b]0ZC}$!Tl|(]OYQeIň;Hhq6}/!2K:^Ѹ'L0>z׮ϛ0Z ,(_o~; Q%C+y_ CKUV"!7k6O :䪔ՙ|Kl@`ZdT b*+MmU+^6Ae @bP ^Ѳԁ$dҬрLj6k4O.冪jIrB"* /M879A=GU8'G kFzVY~Z3/*EQN2+mx.zF4ҍjoDD tbOTzvhgLѠf}펈!C$rO; |2Va \t'W!MbkWf6*,w%%e<9bSf6nS<$*B"X 9⑛>kLڊXQJ*(ļ)$1U'I#}<$6yeZBV#}KrX`A ԴF# k3rOZ@*8*Y'DB0C[opuj&``A&1]W BCOZ)iہÐJYr#[tcc ]̫=QI*QF~xvd {L#Cy`a#ß2v=Y4s; `|vz)RdE_H$;=(N ӾH(~6:O^^, nCݭ2DypY1 \[W0@;?MRG KZHû!0\,%d,B)q}]b:YHF˨ ohXt󨷛 )JavL®ΖCf DCR L 檹d#Va6muOF_pH+U\%`l o UQmlj;QԦSQ" Kۮ8VRuiU.:S2(o  7CGDƎj_+Hm7]TT`m0/;<pnn A~L_rND%HG'ea:#As)J!<¨$* '9M)UR-F/ `9!FXE(7gj$rF6%LlԴ @ܐB{}KE>tPS-0 R=E醑 g54QNwsZSq} p+HatX~\'nUUU-5!s+,,n7`2fLU+S<ѢXtN3g}C_fFjDs҉cACstb=<{zJIݿ\6/TvZ +\c .1NU:pC"Ѯ:Xh䬔mF N**Ȭ]u€1㥒2@ܰ%@G D ZHmK"=DKOakAH4c5X؏=m 3$$C4-.-ZQrz`&OJct{ٗN.S;Fåc#UIn[[lT !&ƓͬEְ s*jȋO K*\6/έVlԯM;ih2OtgN#QF1}6ǰq⣫id Bmmv2֚\7f0n#: $([kS!6RQq Hl9'%t%cjZjxTÛZ*b1o%J5\R3Br9`444|&q BH0NcQ ԱJD(:yɔt˩{w 7+,44Sc)ՙC7+;;:7C':xx] IF2杧^abgSM4pb1 ;5olt*^fxI{[]|NREOJ:Y6N}s YZ.h9+<j9$^+ T0h BJ^weeʋ Qyce#hckey &ֆU:FO#3'*K2j(ULUkv6JM-V=\wº}#QgrHF '̔sw)yW%`4]cs&畘ۛ\`Yf2$ ZoK3VXb/c,W EGIiO*9G96`R+]r:\l9aʪZzql7Cqւ]NK;7<-h%OP UR9'֌' X/cH25[;`Kr2t #Q.("AT2a(.U=RM!{HT l:abS!ff/[[,$jLVO yj)L^KG/+JE$zj𫖒Am.b?\a:G%<ʡᮞ~=r:e]"$ؘJ.+ C y]I/ًT'WRͶM$TQf' [ vqlqR,KQ W >]Uvˌ|Dj W.H&Ş{uƨű#Ti7{`qz-l \ҺO/Va{[1,O2LHe.AI ՀxcG29끂%c ]'!C S4a.V_Bh Rd!QuCUf!\ p$)-CլP5}$X9%"Iάߩ Fu,23T[~*dcP|,Hɴ9e,0)bN--›n-i= mieWUGݤg:<|gKSjO H O6'1|net֞5hgQhT4(( 1 T!\[ۉhrNĒ24R<@:՚4 [s6ÁQ%lH$MZ(neuۙ@șH% ! sb @꧒ (3 gVSeqRK&CY/e WopZܺyEHyv55p4J$`obAcb:poT.$a4k(!1ީv$$yI5]َʠl:gd2ivSAv}a|)2\pv=y_iEeED8c8+KSP&LtH)e$3-PM=h 噢%>w-KCfԲYcFjB;8SkD T <=rxnSg}mQ٪ mm|snga. tٻNK/0f$HAxhqJ}V4p9P2c*Rjj!WEǎA 9 k aq5ʼnЭrN=Ȳ iz4B;74nR,2Hm+e=zGrZ{E|š9h eKfv#4Rln@=IQ)Cٶ#}( <Aū:ƻ* ;dZ\FMM vF^Ӳ$)70 KjM8~58>0E%#I' x7K~I&'"ȠV s( $bt, eIۂŏ!ש;,Q%Mb"˙QD@A uHft2cuU^z`U!hHn}qIdѴ&Lit1„4Yz]R*W8P XmpPmcCP $H>2.H9aQ5;A$āHd'DZ2eUoc]y*M>K$j%V3ʺTJϰ#IUdVHR<*\X)7.ny}lT!*djUnp29>Ex%]&JT -XOxŸs$>avmt6$Tl9ٮ{0';H4`R,bI,#{oc]Vi6bG<G5C^g>*)T>61.*w`l:nv'aְHc{yXa:C*,+RƨPa+E{E$e!A{5-xGKMA~m6PӻQhql} .t-k4A8PGp)2S.ɬW.Bjj[lXa1Hu)$PH9[m%Bm$niu)\r[l}Tr/\4j{ ܱ !HjaYI[}٥"O^ȦF+5t*Z-<'9,֑.%\x7E !(k:uyv3{XMKq&3FuHۖpVpLqS%v7DZb62O|ؘT#ƤI 5 |[a".QљoE|k. \m&m:J2,͏JYSY Nfْ4 N#anXޓҶ]\qW]Tޚ}-WΆ9jWSpp/;x#Gh|6bT3wB۟;cIP}/L U!w6#Ô4^fF̻-XMHïM#8`]۟=DjY E=K( UƂ[/˞ur[Blw8Nײ Cu2T5Y^Y cb}h!L&HG81:8aͿi-o@T@E(}|&͝L) ּ ,yٝ_jټʃp%:o8ܔ{z{K_؜vijd1/~X_Ul N{ ѫ8otۈ}Ε|C2d6d9P*9QMR6 }$K#GO5CF>87L}SL4E4iO2u/̀߮0a2Kb8$z%[CZJBN'ͮ8Ƅ q|E9B*:<2{wJ2!";`-nXuSٵat(}{EYgj+;eyiep-M~qDԤ^k6 g[Jz'icgfi1@r ! %2b"5@6eB, ZeΤ谧`Xb¦Xnʿ `>|Sh|v:wOL{b<.SO马ͭ@ŪXHXR9> w9zVܰob,K'=Spʓ{#X$yRQOUxnM Գ[54W* !](t$1(9i۸e=ydE5 Di pd}Zoo3 >2A΋Ԣr`U Je(ħMyuj)ӽJ;J +]q #Įz"*.YQċ᪘4yOU)%GM&2qHcyM%c2;Ie^91rh^LZz@0k sfx5^Ii}F6! H2wG=`]X૬x~R=Zea*DJ-4wA+p U[1b]!$ZBB6voa-S 3}~weq3{"ن&aLѦEbSTDȡ`me#1X4:1$Wuܐ DU}rz +ya@Ag"`1Wݯ`-p3A?f$-؋U2. u/l GfLb$@C.b2 "wP.`}0]l fS?5zU_ml u$CYjkt#)]<"iPs@*xLyx|0r\K6.mpc:~wl!ڮ',Jouep9$D(,TUGX UKj7|,rlȴE<̨ꚃ[Hyu;A~j[6Pm*G3`Y0E F'Pa԰N3@1fBڶ}1%@bpu[nq- 2M,jk_W4`h˗Vau tId3%Z5|d%.Po $$K0'ȩ*@o[TcRO(R{z|M)_&S/{? I4uJTl3Fh1515?o %+ 1(i7k%fUIQ*pRhpIFۜ.ѿۥ``6n r^nF2ifhmZ(xؼFU"H3v&;.Il|>#ӰUQ40Up4O X ̍WxM5QBjTXt7Da/Ysz <'g3%%>n7U ݟ6ǙabƼqٷ>v,5tOF6Mw?u豫;S- S;cR{S٬ӱYWgLsġ KAm폽f(O|XrkiqԎrX|^_R2< ao6 RTITyٖ݂Iyw7YJ,UuT ;NX00˓HeTTQdRH6l _%`./+koii f\-b&Obx t0ئ`0ݙDyQ+BTnXP1ZӏTcHh9TB谳&8&vweNOK\iTa1VS9g j-n{uA.M\LdNjZ!Gi-Vhlj;-Jp彉si%'P]Tq Sհ]=5ڨSMي*C|8c!+;l6={Ύ#jl+} '6Zl.@X =DlsZv$r֝ǭk} ~r,e3@eS.#M\rUk]XI6TӠ<.HW+Q!rY)c4Ȩr2E\( ʱB:hc͝TsSHW{)ڪ 5Sتd*9ߕV 0>{efĐ%0u Xym`Ȼgzl-L7HzAŢҧ[RPhYf8XfA25!v/.,7JCEgeCAy37,VM$x=y4G Nx@Bc({_īQs&PLuIQBʱI$^FУ!!F5Pz)d ܌M8,׌ֲU=2KA[Oic`e+ `bj&+rȍR$X1k5_2yjK<#Ir ]rO+ 4s KCAڗǘ* $Z7a)&YŸ3,h\!$,=RTk#=^TPӲFs~z-2*wa3O#3#jcݴNìg?CUURÎDcb#iTwnիO ,rw4V9{WV˨X~B6ֈ;wSqݗrJ7;c\FiG,KERɢcgQ Iakts/E}$nz|N jZRo} & MHf6{$uQUcnzk~x4Vvz9X{c~Y|/]%fe3MtBX[\ dJދUvJ[ˋZ*lُf˗kN({<%XG+u#ƭJ{8C[N\L7>tZdvFoCX=-f >APؚ60AZMfSMꧡ`V% N+a:Yopʚ8%е=eAߥ)Eno_:R޵_bdaB7Bm],÷vR #.l Pi(d 3ou,wg2AZeQ(Sk0^xW'2K.eXz+FpՒYdydѤ.՞UR}QՒK2A]2tr=\՚{%VFbLv R>養w8UK!mZX0XO -HTg,ITϋsa] ywk57-40f\ƙ= 0#1`\i|eiᚶZ=/-[)ݍzc7AIE䃇,y]5`#w1_$\7\xMV ) VҍLIBCqL7fZEXz >T,٬py 3GCP[r@&w_$.OC4O H8۩B]RI p07] y$9a]R9>(5,Ҁ*HUus@T2&ѱxgmؒv.X̓EM,g$;f ,Y]4 2e:Uv=/pr{-2UQ*=hTw܎d7t⨤4_d+aUŪt3JXt_}a|i&8冦YM@Iϗ,A2IsSӨ D.)üΎ3VpG,A}'L%(`6Ks'U 4y)zPl3v;Xs6 }g&}IH2l>*Lzu,E#A -<|0'KA %-n f@w{ => ҤlS %ܨn`5)Ac 3q u $`Ybn4nl<Ƞ$%(x<K:{;Tyj2id뉄i  H4՘~Dp t2ؖ:mm}s'C# )(äo/88ԫ7R( j,Ĕ-_MJTdԆ"u=[mt T (]-mR'.@<bN?9=Bu@ A:[4M*icO%Y;7L"7=H_تEJIbxIJF 1:l#㎺ mFpAu̔pS$EKP|X&ʮ̻ի>ԳDLob7Pt J4U*AqG@m|\e?eyr%¨ leltT1!UfʰȊ/5kwFyJ!Sp'nfo~%RṽGX;R^˪|u5&j,Ojma˦b U4 1@-ІV y~'`IKUf²=BK10Tg1l+yrpZa_<֧7?[l~Q$͡>]Fq'URօr6y}aaG)=7ژgm*,(eǖ;3f"]4sSW3a_b"ͺb4ˌ.~\2is̟RUFSZxvT+&ީ[ECɧ<;ۆĚݔ͓fJHb)V7h] n:sYv%g]WSS/hTBc3dpxgU9>Lbu]pjuWmR ܓЯn:^TAGY 6"Ɨնή,Ro Za}'e38e%ij ījj0m퉧vZ[-p"E*_NՉ*ІV_Sz`N[CÎhY֪VvҭL-+ӻkPX=-[}?e3=~Mت)ֿ)dZhfAe2"s^~enJkSImdRTJk̓RsGѦs>ϪM] :(K*6M@nmK5^`šQsf?hߢS(]s.Yj;`IW&vǙOa;MV4,8z0SeMO.kI; ?.AidjRB4FY{LjQ`S.UB#?Z+Yh꫕E]Ghẹ wV3\^ĊҗXyݕ*Χ}svo+TS<͗#BdKXH|ejsTW[<[ԵoIx ^M6IWa!+CPIoA:=[sw.GB{ 7nNOG7ex)JSVSS6cS42 |KkiUS7",W#{٥;?0\'bz|ڗx̵9ֶa`uZV XNHd;š*}RQOT:L(fv!ψXf뭬[-*VIrvw# ZL(N|dխp)k F*pg0 H` 7ͱ[ڑ^- T5H#*&e߮*2G1aEI *24ehxyUr#a} |,pI!["3ŏ0^xia^%vCktÕ_Q}jzV"wKL:~O=B]8wyȤ+:pXn4dhRZ]F)Fˮ.& IVIř[7_~zJ8qi xxoݯ 4,3?]@pM,5<Y)6P}F[dJ:$0] "ik2q7p|gJPK.'e'A%Z(lCv\(*\\yƱzEhᥬ5E6] ءn]7`ǯD3%3Kff`7 r~7@Bӕ3fP13*/r mOWt,=(AO&OPg:"y(enH[6Ñ6R5RE58LevzmʼnRXBH]6mFH)jiT, !@xY'bp:kz犭fVP;\UWP_ eh "ōOҰ 6Ù E 5):WQ`ҷ,Hijqfa'F֦ތ5M.46WI;IQv9GN K)JB=ҫ*U0,T/<ϝky,3.}=z?yڜirEZLl/COG#B -b݆[Jꚓy*"^NgM)a'0kd2/H()Mg8*'hih (ǣmvksPxR/31jj} A(gSqQ$.6KtҦj*v eMuMN}y_Ne})hং6,5: $xVruY<*sTԸ)m-)WijnW$;Ӎ.WVzX}TY{fY5LMa"' n Ԍm]I0egeUZp3,|(:ʙE4կJEm,oc+;5sơD'VTx'Ȝ y8M xg}&-KO+H$1iV"P8@F<;IB("0&m$lE% 38:! X \[0a^W#Ӹe:Mcx~/0y#[Yhxaf=N-ڊ [H̅t Y5\"g.ʺٹ~J =&x8fDxB+kųXnoIv{0"hTKMQ&qT H↞$UT]`-'l9HP|AG"8d `YnЃ~[m1k<*IbSt m^vrbYljK ">rܾfh }qD섗򬾟٫ xXK77I /aԒ,6*#Fn(&0B,˖e:g~%)#֬$؍ [<. N#+"hc  _kTjZZq)M0Ի=.@h2_*inPo _jPCOT2IeĔV/O aoMihL,QWFM`S}#ʚjs-ə ;!(ܩ<]@;Zf|ֲSSɹ_&+Vx醹XIP6, f'D$߻SH.#? Wᑪe0N4z {IQm`6F%@P\ RYNJ)62}Qd,Aq&ҎV;i\\݀Ӱl(xQf5+Ti…rm/LP:BtZx]>E0le.0q IC*aB Jǡ*}846HXxAbE?aK`"@ɬDEJ" N<#8m#A@ akp]zEI:&I$f Oegsm.{0$ԹDWN俄[apP]:LW$JUy4ynj|ŠRPrESRfR^#=Dn0傚FTÔĐ(XKᇊuû8Peը.j*IXKʄNX R\2'b$Yy-- 3Z U֋1`06L1`aLF4&;-v~(svLSML0I)Ъ/lq.>uox2eR o%,|"|X$Ba,Y$>M67`Vl$SST I%.̗Eu'miz:gj6cN#y5g']ߌ#r0#y]SSSF`.Cpyo<\Z q)h#TyrhyC SÓ4~6 j"yLŽ z* LmgU+\E3lQPfO5 SU8{ em$-H(1_&#ǔ,o˕pj]:RQ^a'Q(c~\ê$`B3%cSKנUR|?d1!+Zj#ݶZ.ͲKGپUGU;y%<`i(7ʪ1/zm{#iĵQzd0v*[mbBۡ-͙RH]CK_̛1[k &`L 6m*h:##s1Zt8fdxܝՂ7-oUI0I0B.@nFR<2dZe #٢@T\yMp>)^Hn cg]COOi2 Xԧ̬lnGIrY!Y imF$~:IDnh;-G#`h=XG$0T:\aHN=Hi"+NA,#mهpv|&1]K.asw(6HM[Li*yW"@:@X@ȀSBcEԋJWh\>Rr gXpQE$1<6!`z,4k$BGa`MH0%E*"fm5Z]5WdmSsa˗pq$j*Yḍ@p|Zmaü J|VHgZ0[_7L|:9F\*skܭLY3RKP0hhԱV+rnM ,TTI*0%V򭍉 .,#K\jI4>Em`d8!jc,M,yiiJ"\wpmR(.WYM()F/h o#l5HHBxi'{Z]mUGe F,wR1ۑnAvX%#,3s".YyX/UReHCTUŷā.!EEW^6fm@%{a$B6 Ih0R`v&CU ,B$Zܶ>rБQR~3իEeE@\Z%}&ՊL m܆lu?~}AQ#;bWEQ6_[a5YΏTqd"GURø$O RHJyζ& PK:ƂrG!cb+נ$IX# 8q]vlRST.@ڋ37y|7@>1 Ø񧬰jխb679 Q 링FY3ia@GK>)`LG4sJIb(Rm{ &UYgbJ$@%MFQorImHqgA!Ah ͍VeYں|\j2Q5T501k$IQwRF3eiCORO\g=h^{uNף-(d!&XnVW]SZa1e2.3g0]s(2 WK4r$辱tUv+R iNrr\z]%'G.+$}ͻDBO5M=*< ^]F[fK~/@rF4@~VQ%ƦtX6 猻]u/֍pЯ̦v]LZ&LC65,tZ٪Қ(Y$?Q<\> vmyeݠy#-'gu/IE \XG-#E{ i%SY-E,峉*`Wz:xJI e\n  t0XB ._cij)'Q@dw--`~b($X]|+s(سܐvߘwւLFZ#c,nSX(6_}*%D<')xhjm~~-#-TԘtO3 l,l 1RH],/FCTU+UWI3p6f | HR[\4 ZICNdxFsc|Urǭhdt1̒0xfIom֠ ELNiWޢw"hEFN+nB.V#q٢!DžIo{lMϸv}OTȳ>or& }Y$zDVheCgju`Poҩ2Z^i6$ }F@AP}|$M'̫I1I %5(RspdYt}]F]%-lHHQL HTI<^1# QK]TTyzڀ*/S*.!* &I$SL/pbG=:stl{93% -Pr*n bvqpGH)Xm[.H4̟l^ 2UB)ڣ5JD;%k{@ >2̱QXK#9*4I0<< 4rR"b 5yյcԙFi.U.ԹHYRf`=V`PМٌr¦puP# 9.ϖ҅n&q5M]X%$o{~%gfs c59US) GK XCC)) RCL1tg ],FvbM %EM;bA46ȋa]\6 $, cيHpY|eaTBHV6lRRCGzC*QlW(dЇxz`T) 4oloȍd*zbYP(%nup[K< &&=ol,A%$T0@$Gryi2cIaGΆ/D~O~x)*S1iZ 4Q+X^ mH&xa3:e 8iM)X }{8( pL7PM^1kg"3a^Xk M6q=D$ ,x焩 s-3: q/ʟXrqWǗQTDz!Qn=ؚhhN_*UNj%G]F,>EK}f5AA3 vD}.yS=vGetsٯgi 2) )xPF_{kTU$dh2._M嵑 8)Ҟ e7N#{cMd͖ F$d km661{ lG֤r%d.۵ fMA!( b ݚ߯<7@&D9f2%r,akO! 6-FFAȜf0jr##4a~ި4MK邂BD>#";^Nsb\"]J Aêk5+* Á-'`Ki7 rw2ۅX<*Xʄ;m)\e!}JDW;IV@7錻P *⪆5waȊUCEo{5 4\fQH-\UCϑ7]ÄXces b&e}*K1;ߟ+XjϞ&Y꣧TR3F=$J4 .s(>CiM%qM%6K 3)UXr =-UL&eJBpd2c"Fr#n%Y*z|n,G,2pU u' Y0ʦTVfr1CŅ 7[_ȝL/f)㥏0J+pk#ˤ=/ ʠȡ R`EP\bXp\HW9j59"Ij0[xTCY yi+]$MK%L/MY1,3DzMYtl)jIp"8jhS /g㛽T4TḺ<,Yv6HwvF*e FkIl=!K`{6֫/jtB;\lo7y;RSIO XC9{E=/Б..9xPƮF ,#;a*Frl͋Zzc)^*dbұǬF᎟ 8x 2(|BSf| j@PRoUΦPԻl"tb,# \ b[ClIUS!熠ya(+~[L8%C㞢\m,^n<^nV3v}顬@5c!Ab GTeJ@K%51Hؿ1ÐG80I.8m ceƞ!8UŪ8`>j:]3C-9"zya'b1kiSOD ~ 1bY8qh"*fejUJx}$2VPU͚Er-EDbMvDlv'hyY,0GgM1QRUPһ)/qn4U) 3NR"5H;"4] 7焩Oj(96W4uuKb-k0ƵJ_2ގ iTǜ@#ӆ{3*KV S.gj3cWT%,. ʖUm<]"jL24L(DDbGBܡ_InjF Y^I @ 9r襦1QSRf)]շs|Va.Ϣ)Fŭ>!Ց!f [2z9j%ʲ53)n#̎ᢂ|\7./hd$y2X dCqbIV7"? 0##M ;#ld+"[6dp&HdQX̅=Hyr!|@Ξ9:[%@mya"RV)s KB[ar9-6UZ6f)\Mvm^d(E!jy#;2βk :Xqq~{%]m4QUFl#8lYYn_ S z^U'hF->K.I~l HPUbCSQSB*5AFr^\|MZ[QC $d<3nwQd=.#Xhi]5BEvqkoqI K";0=DeVRK`uר+X& =Pv+Bc$URf;a*A?g3(2Lak:^\aTmiݳ)e;n;{pH)c6Zuȡ̄Wm*m￘ޛ <ÂPY21.ێ"Zdɾ\dSXXH3ɥ;E|r:zQ`E[黅_w駫%N*-C]0WTq*CI0P 2d-eoo<J>$5{p4X|d-YYnO=pJJ- I[2щ;xaX0\u 0bv1* $f2U$hBX]7; M%:IqQN(it"SG>(0\( , Ii $hvX\9u=u]A$P+PATbl&)/ WMo)H:45pbpM]'byz -/`*Rx|5ֹFEqdwyjIh4ph5+c0-})#en{\sMD5ʺQ6/*b7>TCArcjwG;:T [o< Tf3PSL V`O`o:4jH[1 "%ܤHm7ncl'S0̽GO]@USGXc`9hTZ;ooܰӜtf&~7RN-!x_NҎ-D1J,8{#e׵pmB>$qMKLq.4mO*VCW+P(%;d;Üp-@ij+ Ccza:2}0b@GQ$SR0wHd`u{D2G8HnjJFט#4%HACƀ緖*{MWeRy m & S $:3K1b>;!#FfarFAxDm #u!ERHJOWG bHaX $,}4stG!xQ<}l X2G fij\q kሗ'.HkjC$[kU8#ZXMXi#Q;u@8]0ֆV@PFlp;H=^T 8#^4Z[A2ykHBIpf5*r&gþ( 4 l'Pm~xĈ2hu#)vh`ǙbS$DI H م* 'Y.4D7;üFt5= |<],ARpo]st=]@Qi𼀋ɮp98R!SI5T)XL\xld HPdV5F؄7(}S #%hEʡ}k< F/)57ڦWPWP&kb]QpO4,aiE[o،5h$ڥ O,I )#uo Sv*tӕԈ)O<-tYx#xrZHVe1*\s#x%0C6TR9eS[3["@JмIe1CV _*iB* oH$lq$P{WqdAF$m.;±F^ѕfBl]'M؊5/R 2TxfeJ”9SvK#$5("Ae| "ʎ&6`J rhHX\{$YK]LX0 ʰ2fylH̒@XHHTB:'AMURaQF+#f"0HɭbN)}ZnG"ϖLN4u 0f/i:./B7Yb! ,I5:鿇ks\+rQKT٩% n;刈*v=:I{E6sg}JH7s^sLk.W$v0c*\[T \sf3c{]m`/W 9BCUW5>_=#I!$U -< 9IUbi`#];&8n%,9$fBC#p>)&iL ,+ h:ɀl( @d1~V?v`)di FUDT[c|+Hsv(EH55\~d(#tC,QQT,d$ǥ;(uK4SMdliYb}톨CPj#APUb 4RD!9qI`D)CEIW݂ҒI 0).%sJ\R ^- /=yKJ$iHj<~`F;+7ĺeU"u%:ف؋bS*I#yc6i\% ) N>dl'2CeD1 F}*.^ݭ m SJjǀ3(>~\JpͳX!E[>l$K.y)AW4p3iX/ ٯX,; pōu6cxm˗τzADrB&$p>7F*OM(޺#XRMLnU7U [}[EQWteQ*2ʈ)GkMwljSey|T"Wgb.LR4,E܀'aX_nzx0)1JMʰ bsHX↞)@ҬQ۠|4LA4j@h 1maqE=[(KjbV[ 9"zPD~c.G?%߆W2Yk+]I"Mk7{$m;{54riRK#c pp4]/$2~]KNG~dvvQ$ԡx`XX\\a|IqDb9%h|z+O2E8Mq";•rđ7f{*oą5](IbW!P. PRComm {II,rG&09hI+ @q UN㞭TGY& b3\7".W,Fu &{m`9CSo!!`ˡR!3I$F97P ebzaҞC.\ȇ7r]L:e}j@eq$yT ;@uVCANLRONh^HtJ,4ĞpT6DYJv Hma>ytz$4&e o<~3=JiɎcLȰఱ'^Xp4j5)\ږ2--^@$(# ̥ޝ4ecMy10Љx P҉1X9M3}FÑ ^<]5I*>U7@5~ *zxVkZh :Z`YTǮlSS ~SO=ƨJ3UnOqiSQ?~J6e.eqX_!¨ %k,2R\5D3Ge#nWbqiI(`Xn#:U-kzbU#ee3DѰ&ב`PM39% HϢ Ņ} Uh"T *5[⮄A݌1YTƷK%RF7yQask[ $0\TUț9q`"* P8RUd9uVdáÏ[Ce*09si` sL9Y)5E3 H"5n\ 'ُor<^T噽\K#U40I#X*%t*6'[ $IVi櫮vrUHE 2L,$dF4.cYJd|ZVWWdkm Dةv˴i\WBJ$opv&ASf1.oeGjBE%J`26r]>+X&2i55i%< Po0 時Fm5u9DNr$s=0llдiW.LF 5]":UfjcHVC4nI:5Po{`'ATT|^ s܃b6 !(.Ob Zb c©MaUI^>$uAO" ʿ-R jГSSѪL;J"b:m!+aƮ`êEI#olFjԔO]_m 5Ѱ7*n6l dy%SE_^3 $3=qPLVQG, AG$i # \Tgx-fFSjR.ܽF~yhE?Z)2falUŎ*zTM 6 _  1jy2(dli&]Y$*4wa9KjBRm}y*a"H]cSSIXb׶Xi-C PM49eҔӽ" MA﷿KP J\ h#|d2*7%bƈsEC4?udI#4l Gmc熧"p 4i#L5tsꍉ*R(а'caϕ($VRV%#"$-(>%Yycs TTw&R*i[J>Er<[OƲ!+#I@eqFyJUԍB*I\VM, xƝ`IS)hh( zc*+dF2T xGOn `Z$4M=\S2IN;!l]R59OJP!k&l; rn뫠I is)qzwŴ1O<`QQ&x4+ UN|8l3>4Vڧ$`d֒llc]?fQMl⚖,dđO%:U%}֤ :-\&/Y II)b!Wrli 9"}5_MDO(tk݆5ax(1.(5﷑ `d(f,(v!TBn6wxM 2Ylҧ)c^Wd H@6uJ$2̒%XZTi|K *s$r4v(: iA܃sAJUSIyQVWu!-a8:3x`eax3V:ټF"{7[ygHzX`ϵavl8yM4!2Y@AHS3W$b ".P7^DL`X3PRY*BuExQؤp)RKTѣiL)5H$)|[7$m,ygRUTi獾;\RXjRYKi;텽eUMT6gY:L6Y!sbl Yj,XUJay) L.Ԣ=-ar9nk)!--ZEyrޭU'l H MN_eA4r5 7+L9}Q25X;@* ^($U]e+!HRgSRUP"N+K(;$ kjiib˪遒76hA2T$šVP\`^ZTM+2_ky_z8Qbqa:9@1[zl|ˇY"HXor3撿40Z F.`U }OL$4I9T[YWZ-q2EVRV+USffiHd0Xa# kLRLHi`๎EvcAsN)4)#RMY9$IQHRA, DqwW-{C CKS% <9sbY)dmDlIB 7V D #=dqq^hI'6]y"h[Gs*LY4QƼ[{n06m],4I!"i0Cm}l)`s呃^h@Vr36O,%[!KZsEPr Ut;I4FQ %OU(!*rYi m+JF)d U#A<ʬT 8rPyXo@VfM04Y;ۮ$ TE-S<5 Je+I)ԲOh;Xb7 l[R epcyLݔAuER:/ 5rD4L塧TiSoX+ u0ncK!颢 )d"5as5<,fQYafSp{:uφ $ GֲO,Ck0" HY"d*fH)݉6e{{p u6T"UR!e,%{Z9B>uK ,HAo];a^z\uG-2i.cW2Bmb܁_T)X&>">0i,î)H/`)IE#p ^#`@~|O=h1͡Ƞ1#XR} "ANl9/QvvHҳ5M49sVtjr W^RŁW=,2k4K9BH( [X8bp|%feo򣍵W;<0P!\T$2Dk}Ha9=]* 9Z0`gJ8MC,;>g483 QPKp0D>ox F41pj4~, E-:Uڍ (j8 ;r[PEREY5*.#^gcC6;[i@̡g]E΂$nG _ )-@ J`mé  C$R*Ig=q,ychaJja;$Zg6^+`dqQijB#&-S^|ʢ>.^C,9`[.,X]4Wa8Au뢒._UUR U Z#of05wifӪilw-0i:.Y=AXC* =a#Sb\9r);KS3"4&k_R6i% ّQYv róZo9y EY'1=DZ0 TPzm$!rW&jL [ў܋kstgUıѲ(%5Bu I#qnxW[gIe7i%eR3`Y*DTS34K뱷©A'cUpBH)9P2`o" j)ij.T!Y&R# wRvٜz: 2pI VM;Zo0\5dd,nʨ_,-%6K;I}QWO;j@b/"61T#}6K$bG[X٠EpƑiA}J$?XĴb%V6*y}[ ?T2&kqZXIC0U#TFOm>{ IFYV`<Nƫ`p䝓 3֖"#i]R@|)P@pHۥG0,Z *戴NT ؍@62zJgz:MQCs<ꎆ C]QG U:!F׽as1MFs&̫!)c1SC*Hm#u0^ ,u4y|sS7@陘=ۯ,Ol$|vJ̲Y^fƞ( \o@U>SsV ygyUUQ[SiBUS7"- R>H: ;c/dzy&Br5k"`my1*(ˤOGX4k_i2E4S:lG,BI*鵱iD[\IA ]jue 7߮fe97hbh)zT$IJ3X7߮%#ˠhdxcuJ񫪆Bl i(hfZ\֗SC? p16̑⸂HCMm=C| 4|I#uRV+XݔmpN¼"<=Z[E:%L񦢅O[\Yl$žyAvJ "ʖZ|j^Zj}Zadq/"(Vqy&E@冉*Dћ>,od(-:D*2ڡbv‘FgYVA `u%It $zcdP{bruyK)UQ3G SrAÐ!֥2@}ab>fE7P*\r;8 KI h*`j39 0nZMfs l/OI#E c!JMc,+lEzX&@˗py2UjR(:m+&L(OEO:XAbpr"VX5!!@,ۉb)Zzdsui4Kĉ"[v.(%67h!e̫5˽@h5Y+5KNJ +$vwBG堙/ӅVb7i=`ZCI5MFc\%\ ]At#۞ !)cykGѹSFe.AֶƠw* lTQ5d XS:UvMI@7c`"L۹_Z"k2p1/ln- Oq̩aRB{IGC_7#B4Z4ccC0SvYbKF8.g)<Nt:_WE2j (qI [`1J" >YOYPK=CH.~ -~xwE0N\1=+,^(eT(.JHϝk`hv 83S=%4FR[G+s2EbmEܪ 8>BTw=B YTVMCT-Sg/*8UR9,Sl(Zpjj\LUltam_lD!eY*㢖e n^|j@KHS#$_ Ie +j*zr"F``ۍ.ibZId#4 \&\ÉpECR⠴=F'( _aJH v\j斖u=QVȧuAP,,N9>5kPZ9#U7*%[nX2@Q RY)u]cas$9LʘGM M+o> „r)zGEA%ͷcTj*D5T2X^`,dS*;:Gw2^0"ڰL%SGAEO$tF1 GRҴIffpT]n%K¨3U*VbX΢-qטwWj )G!t)59I.D=JMWM#1dd%6gbB b3Q\9uTF&FnJf9DtGPtI$S4-bMF $L9jVPHƑuYsps V* u2ܪSp<; 湂< cØ3r6z_ )Y#H@7G<ӊ47E(MGrX3"/̘ PV"8$ 0(u;b%ΨVzJI` ]Qo$gD)S;A*S`,?yZT;.jR [kuuliH@Tx5jq߁—$A=<1Hz$Y*^h)֢M`/bF .Y7sȤ%Ycͦ@D0F<'p>-RܒN >a('i:)r>a 2%QXMM"W  )#摘LUT5>$;剑Ycr禜U,-r=5(R)X4qiaQ%PH~jcxYuƬ tد|[H*t 2 V@7[M/ QLOVIiIO_n%A! Fƹ$NF1T!6|BN,S3\mn/t=yd &=Y(hp _ 5B͖1+HiӇ4K&7*H'*rOTX0byiJdu.+q:i*Ԁ.gj@WVyf)k[k` }4H"4%>>g$(D0SI0H )~>}LL6k%S lw  MG`RC"T1h) _.42_WES^!S R4x[0D,.R5|t1U I1V|e&mRD tcV@&2︕HA*.bdtGYUxkDزJLc,QKy`;1(tZ{Ä: j'3BLR VT &հq8pC 4gZjn(Lbs}ƥV/N__ *'I3(Z81$L0*4-)cW4%BZc(5`I7z >dP4R(Rj gi7&]!JIcW3ӽ@0Vloq{X)% =<\!ӷc!^I= oTT5d aZdkBZuŒ6;-y_<$Fj*d%dN d#o<)C<A8hBΤVm$,6üyd:5__OA-c፞Njn 0BTιhfViDBdrH0>H58pzy.tFK w˜E$x3|&N$ #(UU8~#ɰ1i=4 ܺ vyYb|*E r3C4E0eYҺk'@#{bXi|txsq̽5L`6uTZ37m ٚASJcte ځkVĻ!Lʜ `R9 E[ xFmnQ YIMFՍE+Ϧ:[B 1skl& a"6:#  Wn`r=yaKcdTWN̳#C: [ϦC> RO8G[o˨Xsbp(;@xS#ȅc齃T[A5~ԏ9c9-~ A*+j:y^z|eVP# C:oi<:iG3ɨ&2?'lN#3Ʀ Fi  FƝ3PL6yirT-@]Mi/}7-Feˤʷ^at0Hw"I3TyRH;U:I ͧf,QaT Z]I %K-ױ8iki3дK{1x`Zy`jE'm,QQUNKMOF>$VI $[c+rN,ht EālwGXwblT8%<ff0Ly,5BO[<MvLoFVe=|om~,2v5f.OwÙ1byuAy+yB b5]V!ml; şfi&Ɖi$\ko9y*Mu 5 3IU$D5w\mh؂ qY25jsaem@(yx{P/%ePZITd&iGb#<]@e[EU&g uV0x5KY)K;I$.QG%,nZY-}?)[%@"WMjgXC XYX/\H@FBN} i)TKDѝU8NkƊ" PkZ1S9]KZ1=XPDžsy:b4%l'ZZJ5TNQ$ C ҤV}J)]P|)/d'M‚7H$,0'yQ1%Yj[aSIxR -@!!Q} "^4T[EFzPJ@nN`@^42LEpVZ^2qMBWWnP #FuK!w,.Hml9>)aNeueXy1ӭlJ!IesHתC 2k=9\fC$ɓW= dQ==3ʥ1{sMZjV)n$o E$vI:AZrF_$1#$Ϊ >wP^^\D`Y]IW ,V듶!.yIV=M 9rҟ@ݕ|,UWȁtQʫC㤊%R[^tpkIJUhcBơZ{_)QtߪBƩ"B%,9BsasLRXZhTSJŮBRbXtG :G\T&۶6 <#YC,DU2@$v?6  ep I련4uD_{Q~\CZS##eAiqۙ i ,e.,2G82KKiia+Rfjd``^d\jT{mISIʒ1sYt9&Gb,qP؆:jxEJiP-ryiy(% * b)'R/+ߋ+:F%G$Ȱ3Ի_qTR-X8%lվúHBL) Y:)6[Λs#@80igj&Pr%Z!OF0 @'fG+KaSJCDJf=F QxI#P⮃"w1Iʱ A,t58P.4U"]^I1@-N-G^H´rzNA5,l<8% &U!~(&k\I~|Y 6_4/ҥ ;YDFh96k Y44R^6a C(U x&J"Zx|­r#aϙ[Ti.əQ#KM,Ԯ2Ickg[aK"fth'I sgC}}fRAZĂKH$}%APM06#M.] #1 h}1pw2 _c+ B.9\f')K.CR`JE!,nQJ@Fә% b ){{D 惌KA>Fxpm{ă>t *z«0o`7`0JEA<5.JFϥٴD+{ùp^#@cI_[⥊u{;-3G)t$ (u;T eHԔ \nqPMV M4Y"oϖؕ,xL# fC,i<.)-^cEOQ$1 ebN̆H߮'KDb nGR`ZuUTM60ENncr#me8zE0Xr,{큶,uR$4*Y2wk&+ԿIAm{l,7`Jlu.d"mh 撆{` yn62:4ҙ_1 >۷,*qN:TD-10:X܁Tiri"W8x8aYؾWQ`J{i!UJY[HE(Ǟ@8:Y܃Ϟ@|UQӐ 0+ ݬoq QiJvfw6[$R*nTw!'؜%'=D #TSf΀[a{&3* h䘐IPԌl}aXW1横dS@]u 6@ոc@jMBETã&ZJ^ $R")YJXf&])$^J*5iS2^-S@j_˄H5Pٮ50eD-˙&5 OUU&3 ;cT(m&^oGn YB$4p" PȾesMV YܫREiD W <h%%.c:E=}D|*Q5bض)ۨ⚑2𢥣SSAKk2Kxö6*B$ǚ08XtIҤ0Rn€$4FFj8f1ۘ+]m&GNfu? UXw[{ `@\;TϞRBS`7#aQSS%=d2 UT`n[/3޺YeWL8uHQ@SsW71dx>9"#Y[ܓ` dR@cE$":oى#r- 8-, ;n+PXGkl%Ro3Te/4 NOib.tpv,j@+)S8!4}-) cm2rBHE0&gnѵ*p5U0zŋ? c{ ߝ(EOJXŗGIcqpVx ZZ@st"@'iХ!.DŽQTxԏC'M}] ০q" -mGQ`5皮EF }-ځ77‰DE _mr놖|2+) ,oMZ[ሻ_][Dq:;mU#(%cÝe֒))e$7uD a7™>") S)"l/b{\n,0|OM,sEX*X7 vka<3T!U$eh.aw tZ$y)e%!N,i[uX0YV <&x@QV@A,n/?vI*Z"U |MԷ\_bEL1&洚p[Uӡ֑xur-uQ}l5@|KPѥ@jZ`IQamI7|12+WfK+,dr3"4^3(j>iC"a5$pkmJ[,&[H4qT$sU X,X{B&1⾞bBdܝ{RZzfU/܂u d.!(:*8V6Wa xm67 ],2YX5&tvlH+_OQtm7ോ`yXD`5l,dKnwoj9)d*ʀ5||-, RjQY kmEm|)@[4 bBdfs7KX8w=35;$ ٜ r݂斲 IјuZ{)*Jхe~ JAD =+fP (hΒ>" rQ3TR.1r=&A!iU"c40 5t,Vܰ` ,d%daݤd V6+tMxQ5R\Hc -(#/&l#0%$Q4kkz]H cSRw[,f +=^ŀQv|7KQ hfKp7$G x9uem$)\G0Ī#UJjT0]@oof+|I5X߸2+Lo_M@Sښ%(2_L k myp$8.eYn]QtjcfI2{ 0}kh$Ĵ2q_Xlj[I|8O%f5<'&-x(vCsk;&i qݙIX_x8h!2ոQܡU(%H,IOP5#G#E`4FA"TѼx4V7,vsm:i fSSjYڣW`oEʌ6XJV9 hD]Wɻ$\꺢4LEĢRWbIPnw،'XjJBcxQ~S5P<0 fU9vb"lZz$wl3xo.X&rD3T,B?4:dp#cDX{du,MC06kK K @S Ec]-m)SN%.L#Tm#ۨISP4oS+B ;|Ay\_$9E3*H NQHj XvE$|I ʪ³ƑP TmJN<%Ysi#H]ȑI;R 5.$+0Qԩ. \rˆa%™el2!.HZwyw{u />c &1`Nbǝ~`saEL20ʲ캜Y_R$пx5]VO; `LMM _%$;&e U@遽H`AO&x R4bWbDktûCJS0.Ezƈ[}M&r{<4 -.w$27EŇKLš*i2j²2SY_1Yɚ1WuTDmubvې x5|mMw‚7b 8W)MehHږ\T .8qߖ*, j:i$3Ĥ t=~q,tE"Fi6"`Sxh% 2%m0}Є2KILRyjfR'MI``} >eҬSǔH|gX[Z{ Ul *g9|[+iN_U,ڣXF&5{i5 KxK,T`-8Mu$ :膠fM8ԡ%>[yYhޢJB \$Pkp%>ZbG $ ,f*FyaBiQGO[3.!k.}l.V! %0 ,cP6ܐy,:icYZ He^[(66&"bNEQp8Xf; a2ȭeJ̫j'kaH W x4F 7 .A<5|ӡٖҬkvo~  I4SGJIJǬ,kȀMb]@D0%<,SFUvu)m VYTd,nt=, Ais 9g^ -!̃t2~P0ĖP DЃ $#TSYG4m]w[K"gC~[l'Rj3T`惆oh3Hƶf6Ӗ%֘SXXYDr@ VpL U#ˑZ]y)$s Mm}6a!XTHkb- 0e|žxi:Es$>WbIN0 IdfVv$ݑHV4DY^hIrk@톒bUGG,NB!q#ȡrk0DCWp@@O-0P"7s$ZU!d}/儁H^hcԢoldERr*0}V\o1U `I4ҤQNj&`nYdoq6Ì[c1BF\JB [b<-eaXXHb$PI%-L򩑓K e&H 9wJx"bd!%42j\°"?ǥս3k`m D ʴS 0󰽶x 1GW 54T.'*#Yne-TU9B^TҚ>%cUmqky*f#HLU2kKK[Q m>p娫`U&:&_R: cbo3:4H,.,AvXnz_ V}L<G"LV X JX)vi9Ќ.-d$ j$t4PP.IQcmCtt㤑uM+>j ]iRBfRlr|'W/G5=M h *qGF,|!2P8NB$qۃhs\ UhZz%Y$xJ'>yԶAI*1HA ,aPl14$iY*ֶVvUP$sk }9Vlڔ4zTpI T-%*(Ѱ^#H"ַMB y^i89uBDS{"v9zrIǨx%ZJA1Ӳ'5,`{.sUTGBQ =c+I4,CG,e~{a *dL2`rRcLx{c֨#M2":Wb(Vx'P$}EUIF%35R>AX/@AyJGt2Y_M:m&ZdRTLe4# NxV+VBDH -(Ŷ,,Oa D4ZѴUfX7/if+ x5BpjԑHЈ[| ~o~XAajFB¬cVIS̎K>0>)j*g6̩ Vߖ Ck%jhfx4!:Ս ;bZayrzč-\ttStFuؑ+勺)|U8u0Tj!Y &ˤ|a,ApҒ`[d+"qxԐFlU&d1JKMh5QMX@ [m|8*RC q *t (,Ʃ⊙ ] f<}E4ՔdXx/a ,-=o䘙F/ $][ГUIR 7 X6ϯͅt QG_:"H`(l.޶(o&9"WRG׼~Bc yD<ٿ<-,pbz_aD 9W EPSHEr.9yr' &ͪJVSEGHP5s5@Im =Di(-KS15QmCQk&8.eU2[?UM bm+@i$IMAz{@ė%%A>(̪)Z5 Q1$ڛsš6 *_D/HoXckXkq:eH#@^ģ0]c3J*cG;A՗kߊEg"TV1 )B>SH7emL}Z禞 SN Y\lm~YJ*`:,\^FVH5\\UQaNr@bY+-QRD\}q2d5FHHcft9'TomH 4N4>1 GvC hrc( J\Am0' ( VWeFcE JǔƐIXdqNFEܙ bfI2 F 5qpy7AZ<@QT9]7$?4 u _fMV<"3#q%EfLH\q,4,DwW 0ÁI&WU@ji$y3+\ˠx b]L6JfkP&gm,4ؠKWT\xdBߖ-2CvkL =5heSISDRn5TujQŗ˦.ɶuj=]IcOyaF]<wf]Rx}j$ 4ݟ$tIS*#Gm,ZإHr*1UT m nD2\TU VYԬ`W78fKyssCy bDoUJJTȊ-ז,xsǂ QGG끘XZ tdTuٽvcF%dix" u[C"F2ЋBl [G߅jE)"8 3 >{ahoO+ bjzX*\ 4. 8HUpR >hi6K TvPp} 0,T$ƣ1HRZJ[00Dc&)uة8v)3(v’;4]ʋ_QoOѭ,HiʆcPoyÉÞSC.))a7t2]ʸcm&mS,n=M!SO؅6JTLi)JJ@+bCa`m(Ueқ*&F)"HFH;<%v9(*LfB@k\3Mi`EH($?)n0ʕc0k€QQiYUBB kWH^Z@MZ6I-3.r@?({i Hf^\-HB3k%[ `ʪLS'b"7[I5Eo10LG$6Cث\C,exiyؘNY%.@ˆ UQ#EbG?,L!S.Q)j(å'NB_,8CrZ,#hB b67҅I 2aI^8ŏ]K욇Sԙs;RGBDJj^:uЂc$b1m;|5Ǫ) ,@! 0ht!Vōa*D4Y\Q,AVJ2}I |eK Ҋq%k#Er0$s0PEx5ICo`t 6%0Ȩe4":hS,CVi7_ -9XUVtIEP藾(.A?[` -UQ43;LPΦͷzIS Vj܍_18$q$d*K |y(v[aqTf̬] K VI}ٕl#l@j%<8!YGek:o|i;08 QjZ)mE Q3Fi峸YL59V/t}6=Y$|'F/,hE9ý z8`=xR1= <5j7⢖AtɥA c{ 9LQU)9tz4Y=Vߞ&)8+ ~EG̔RS!m"ߑŨ%f`c5 t  k ⢦H( D]QЛ:mL(T;C!6YzJ3:IU:2*/#K)]L٬t|(&k<.̡Isq5S--lSBj^D]BMp'ĕrrʞ"81xg2J7hfQtlHĴ,E.hD,lXK/zRy!) bll ~I o#@)AP@ 7Q\+dj l̂G.$/LwrN#Ygh(*K#3n`|e2,)\ ^ǘ$J*U2IQ80ʅ$Faz|͔Jwb\ *9BqEY!b̠p$l\FHd"vo}Hz3\X8 ,2K3-7U~# 5-hJ).eV<$\aIiUPA$leY:*fXtPû!$Î* &zVD#v>Ĉ*˱۞RY(V<:}_q@3JdjɄ)Hp%kG 'x e(N9aư>"43F igbSse„2DYZ6-I-0!*rVO#r%, ^(T$PQ$YBw:{A$@E̒e-܏C \*MX-3A &fW`jc#2ֱmHbbAp'ƕ/HܒM:_ IHEqߺVBPygRI*.}ƍ"/{ftI%vI ܨ>zd.&$FY0&\+O2yul$f\HkdjbnKrlo`a bX@XnGI-83QxQrj{BgR;$7+وȳWJ Hxm%Uu{w*vnF|Y_#CrXd,wTtt'ʦ10 S{0,ӚLp~, n t S!߾A\7 ܔ: YS"&-L`bic< +ԙ|r4nw{`DGeSLԵTk 6Eʼn YLa:8yv#r p&8=jESN:+ڀ.H$VT7B]]Ƣ plI4ȿ 2F^w @TxhhFIV25[ĦGVIn$bLz\o<gUSS3+r/ubꞱ*H,ʱM. H -NMLt2:Em QSHO$UQʤX_cBj k5'ukr k|+ YudUyErv<|=;L/9bcj;Qo;})]޶ X_֍I[ ]!9ASĆ9YPz됺IU[n}+@hi M `<` IM %i<2ѴK16"mF'Q1z_91.^O2.|%W ppT ; zi꧕]wc`<1-r*,OQ,+J.]x$qA"TIMMm , !ov"bRO;Ҭ5lƦ3OkaRz:zY\[m+{PK-w壄Ku^@3DM+%&ꫩ'RpHH*q#MƠ7>+0ES1om>ͪ8 igaÔv\UU$q*ǘ`lXxpߟc5R"An"7'g&8bN-L 2ATV`a{\xYV$S IG{:M TĹr*jHVI@MyAԺ#S9Qf$0$&0+ff4Q=Gl ,@.Yqul{p:BIъzW(`L@Ge 6`}+U S,p6h yە%&Fe&IpEpl)^+ȵsG@]|F)-沶JVN$>E/3a ͤMi*)@U1XIV\ XTF\){r\Xٍ=< BP(xz6pUKl9[(ʥU؂ؗH-*$#W-c9`T%DjȂ묱pm^*a02UeD=F"L@\hvwԤtb2טq^j] U+o=4 FF @+bLXj &^쉨+*LEp:u 0KTi}1Hl SAKV@䔖̣}H,ƍEhi7pCD$th(ym 2+ Xx,n9<gj];/}$f3S稦jy(2#ji$$mfR⋈Agʳ( ($ 2 ~ fZU#F9e8HA--}14 xʞW{q̐2\2&*3 {6x.[I[-w1U\ Gx=G٩x̟eEW cJh&BC%P3+kmH_f W:J$ʰ"HI \{qnQKN h fi W;ypcp|'}2ʴT1Xb_֧Cb)"-.y%Dt1+j;$܅LhVGQ bIQ̒_H&:|:Տ g 2FkmƋ૎:9Ef˥M@ ja$G' & >{␉) PbxdUTfBw]aNUޠ5PReiV@s,SdC{-=DQHgMKcKIzlKSq>C[ +JI"qA! Sĵ$X%f^igd(]# 3q]]3iGK,m4Kk+)CDD @Vְb>ZꜹFUz7=I@jŮjv!tD)KLtG),L9?h'd/ؠp4\b<1[X¨@‰C ELJo#9$WaF(B&cmJgXW1 ]E,E(GWuQҮ(ܱ +〈Mu!$*bǴ8r!F eHP l4`!" MKS@dIp#ӁQ3TgrǬ Z , xd+v0Vcb_qt)cn@`m Hf*.>%>maJ`pKBU%%#$V;ۦaʙk#Y[KLhU@F&DzqQ'i*>NFK I&y*@ @@J+5I6<]jjzY䒎2M{7E`lD貜V&Z%Z(>vpSgiਉXD t#p/AMJ@#E)BЀMēTHUeuH,7f.Q&y䅇G wlvͽE2I|-Gy'fm 9śN4`F1JYHP7B 2 $UmRvrĺF}*J b ")b稱>xfx*)T[]9.ReTMY,A? P>P%h3dY%J:T 4Dx> jw&"]أ۞ %OZ'm>=`"jjR-'4%j$R>"O8<Qe:Vװ *x{/M$nfpZ3f/:Kw,TkqJr] ih9LIjrx;!OѴh=/LTIW!5o5;{涡z qzF^6F)>մ[/?J ̾+(D̠ %ӯ`7)Ԃ+9M*d1[w%7u*KU~@tm2HQ򯫞'5.QjJM=4t&$]N1K>մ['Cϥ:R4b!"olihocZ#t(ǙSմ:T2 'eh$1g'P84-+zu S}hQYJb -c|Rvӯ` zTP 20+o{VV DBNИ%+V?Lo|>(okNB= !a`6m<>մ7KoWT4DzBS`fL˜ {V02a(d"@gi<ܖ(ok=OD>[0U[A} ihoEз؝b$XE%nNl:"d^3iO'gi!<Μ0^A,F)L|zd)j!OĶa]ij >=.F^f SVDRpP;.T$B؟vܖ(ok-7K..]$nĂ!s|OA\#]ZmDR\(HO*{FBægN?nѴ75 @^enѠF3*};r66(?H?:¢6VnC6FtE: ®GM4 <% c{^5mAUHM=4"SUA`z{{VIfuQ(t2"s7{VѭH:}Y{chh 9C.d m5m^lހM&YPm*ѳu& Vװ#bt9ˡCH߄ {h!K>zI/fns*}Q @Zjڅ4b )SR)_,׾%n;Uܡz9#Zeh.6n-kmBv= zN (xVV"EbV%} V9&*G$Sǘz 0vتA.:֮QTlƙ"ܕ m̳IѾas{ynnq4;Ei[$Dw\*]>kU[j *ܪhhd*{T1= kjA zO*tvn`F_ ߖմ[$JB^Z&Y-,ri5WvU$B;+E޾~[Po?ݰV[l{lylUX`+[lUV`ylUV[lUV` *UV[lV=`=` *` [l{0V[l{ [`pXV+>lUV[ *` *UV` l{- *` =pV[ ?+ `XV+ `XV+ `XV+ `XV+ `XV+ `XV+ `XV+ `XV+ `XV+ `XV+ `XV+ `XV+ `XV?+ `XV+ `XV+ `XV+ `XV+ `XV+ `XV+ `XV+ `XV+ `XV+ `XV+ `XV+[zV=8f4q蟰Dj_~>ѥ6IupSU[QO)1I4!I$oa 7*ʏO55yojLݙ0İM}LS#wc^zCG'1Uji[Lj!yN6l:0}~臵u9oge̩* F6 yrGP0/ILzOIl}$.soM~rmoME?1ȲL]nfˢ\38RVY'8fA۾v{S]\,zJXdNH(# xϢG~}Cׯ^}YwWlOeJգ^8R7;.!O,vk=(}OfzXowg?Rvûftؤj0iCӠ R6!DI?z>UvnzdT؁OESQ,S%SM5l3/;1يG̫x3Tp)OTf4 #/oUug6 5S.` endstream endobj 64 0 obj <>stream Pixar endstream endobj 65 0 obj [/Lab<>] endobj 66 0 obj [1.0 1.0 1.0 1.0] endobj 67 0 obj <> endobj 68 0 obj <>stream AdobedC    @    xab 18QUA!"2BRq #$%&'()*345679:CDEFGHIJSTVWXYZcdefghijrstuvwxyz??TT^T@[8u:OK?Ky-DtJy%Q!D^v_Ki?TPo:%SΉ/:$J$R(h?Hj֊ڊ8KvOJx#&tJyQ)D__)~U~UW UU~5G O O K FDZ C C|t/Riu.[ΉO*%bٝ㨺uԟO/Po:%SΉ/:$J$R(Z*hhjR!`a`!`a{0=,nj 3ڂe i{Y=vFr]ݗd`e=v=;v]ߗbؘ=v&~]aXX9 VFU``%X9)VFU9)W{'*w3\]ɻZt9I7k5I=irn4+&`d]|/&f@}hu_I娥tKyQ)D_)~UߥgEYU~_5G QSCSRCQCPCPCPCg`{0Y=lnj 3ۂeӸ p{Y4=,Fv #.˱{jw.˱0{L.˰{#*ʰ0r2 J9)Wz'*]rrnkvrnRMrnernc\v3\]|/"fy7W5Ⱥ^Es.kt_ k,t\.KUgi?T_C˥SʉO:$J$(h?HjhjK؆؆؆؆؂CgS`{PY=,fn 3܂ʦۂɧqAd`e=,#ޗcӸe=v.~]ߕb`x9 vBUa`%89 VFU``]N㒓wprrJUɻIRMۧqɻ{v\ݝdݍ>ul-&fy[5H^Es2.kt\ě$J(١ʻr{Yu5 lB!;P(|oKyQ-D^tJyQ)Q%DD_wEYV~Ut߬5W QCT~~~ԟ5 G C C CقAf`p{pY=,^n /N܂ɧqAd`e=,#.ǧqK{l.˱0{<!.Kr#*ʰ0rR;JUJ99Ww'*`]'&\vkvdݚ{݊tKu\l/"fi7[5ɺ^Es.=HYfErnCwR =*؆DñE0|oRiuv]Nޗc`eظ=v&z]b`Xx9 v;FUߕ`e89VFUwrRJMI99Ww'&`{v\v\dݚ{v3\|-&fy[Oy7[cyS5Ⱥ}HyfEӧy7OKe]p9vl;kن.h~CE?:9u ?O/<[ʉo:%v]Nޗc`eظ=v&~UߗaXz}g!*Jpr!*J0r2JUާqJ99Ww'*])*I7o'*e]ǴY7g5ɻ\u\]l/&i-&yW5HbEs.=ɺQCvA%ز =* b0CE:(tsiRiyjTKyQ.tJy%Q%Q!QWQV~UW W QCT~ߴ5<5,555 5  ~f ;ڂAf`0{pYx=,Vr]N݂K0{#.ǧq˱{\.˱0{L!.Kpr2#*ʰ0rRJUJ99Ww'*f9Ws5ʻt)*dݭ>vkvs\Oqrnku\l-"y7W5ȺbEԧNd<+&CF9)WzL/~ &Dg RTv(>y7\?T_CD*%SΉ/҉/:$?J$R(Z*֊?hj;bb fb ?قAfp{PY=,^n .ǹ܂ɧqK0{#.K{l.˱0{L!*Jr!*J0r2JUJ9)Ww'*]'*fI7o)&%]+&i)&i7c+&i7_Oi7[5ɺٮ^Mr.ku3\̋M=Ht/&l%]p9vl;kن. h~CEg:K<[ʉo:%<(KE/Ҋ/ҊaZ*K؆؆نقg`{PY=,fj 3܂ʧqKi{Y=vFv]ܗd`=v5;v]ߗbؘ=V&~]aXT9 VFU`eX9VJUJ݆ÒwrRNUINMrrVMIYRMrҮ4+&`|-&i[5ɺ}Ⱥ^Ms.kt.bMrn4l]P9,iu50lB;P4G;ξῺRjiu*%KΉO:$KE/֊h?Z*/!?xj8?xj=j=j=,~f ;قf`0{pYx=,ܻ*ǹN܂˲0{#.ǧq˱{\.K{< !.9VBU``eX9 VJUʻ9)Ww'*`]'&f9Wn)&;RMrnΟmrncGern=ɺZMrnku\$]\/&fR$]*{t\;4PX`{Yr =j؆DѱCG;ξῺ/P[ʉo*%DC"\;(|o t?J%SΉ/:$J$R(Z*ahj``!`a`!`a{0=,nj 3ڂe i{Y=,#.K{jw.K0{Na˰r< !.Jpr2 %*ʻ9)W{'*w4kw3\vrnkvs\d݌l-"fy7[5Ⱥ^Es.kt\ċXa٢%*Ƀe˲$A{PT \0QC|o%V^wEYQV~_5W QCT~~~԰~i{p{0{0{Y=,vj7ڂAf`{Yt=,wM;r #ܗd`e=v=;v]ޗbظ=v&~]ߗa%T9 vBU`eX9VFUwrR;NUJ99Ws5Iv.RMI]irnernkv0rnkuku\l/"yR$]<1"f7O+*KgI˰d@`$A{0եA ֈhb:9u ?Weuhi) MCSSR{p{0{0{0{0=lwnj 7ڂf`{YT{Y4=,Fv #.c=v6z]ߗb`ؘ=vB]a`%XX9 vFU``X9W%*`]>wprrnNMrrnkvr`$ݬ)&\\ul-"fy[5HٮbMs.kt.fErnl]Pl=v,:r 6!{ɂ(yF>y7\w*6.-WRȡ`!``{0Y=,nn 3ۂe಩{Y4=vFv]ܗd`e=v=;z]ޗbظ=v&~]ߗa%x9 vB]r#*ʰ0rR;JUJ99Ww'&`])*ݬrnkvi;+v).VMrnku\l/&湉SOyRd],1"Y7ZvhJ`{uIPlCCaء_psr=:Ǒίf0Y=,^n *ǹܗdӸ%=vFv]ݗce=v6z]ޗb`ؘ=v&~]a%XT9 VF]``e9)W%*`]wprrnkw6;+v\v\dݜ+&S\|-&i[5Ⱥ^Er.=Ht\̋$:(١J2r9=,vױ ^\;h|o[;;ʬZ[=34#.˲0{|ǽ.Kp{L.ʰr*w !*ʰpr2 #*OYJ99Ww5J99Ws)*f97o5ʻx9IWk+&fY7fdݚ{d}>u\l/&fyW5ȺbMs.ms.kuaf'*ʃgIKA{pԤ ؆TQC|oב{3.F=-v]ޗb`%ؘ=VB]a`%X89 VFU``%X99WO]wprRnRUr=ɻx9I7k5ɻ9VM٧Y7bd|-&y7_5IٮZMsnku4ku3\ċ$]<;:NJ]" "چ* h~CD;<|o֍:,6lz[=QVf#*ʰ0rRFUާqJ997w'*])&97o)*`$ݭdݜ+&S\\dl/&fy7[OiW5ɺbEs.kt\ěE499WjT:NB]"܂ϑm{ɗ4?J(|o 7Uș=nu NUʻ997s'&fIWo5Ix9I7o5IYRM٦݊{v3\l/"fi[5Ⱥ}ȺbEs2.kt\ 4P0l,g RLj%<ts l>7Kg;v+&fY7fd݌-&Y7_ci7[5Ⱥ}ɺ^Mr.ms.kt.bM9IWb\;:NF]""aˇbGY:VV&]]Z\Oqrnkus\\̋$],/&QFNUەΓߗcH Ƀb !آ饤>y7\ҭ45;7Kw:ȺYVUւ(rR6^*Dg VT6(y_psӿ4.(b<'G;ξῺԿt.6]jtsտt.6]jtsֿt.6]jts׿t.6]jtsпt.6]jtsѿt.6]jtsҿt.6]jtsӿt.6]jtsԿt.6]jtsտt.6]jtsֿt.6]jts׿t.6]jtsпt.6]jtsѿt.6]jtsҿt.6]jtsz P2Y [ve>ggMS#OOOCerTtC6"ӂ(4Ҧ^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜Vzo5~kCy's^"y8Cykj׫Ȇ^N+P^D7qZ?5!ד9W 漜V0tHz5n?F[óS;2]UԺkDZVKN-=:t endstream endobj 69 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/2573##K 4473 +Z)虙XY($r{(sr = endstream endobj 70 0 obj <> endobj 71 0 obj <> endobj 72 0 obj <> endobj 73 0 obj <> endobj 74 0 obj <> endobj 75 0 obj <> endobj 76 0 obj <> endobj 77 0 obj <> endobj 78 0 obj <>/Shading<>>>/Subtype/Form>>stream H*2PHwR@q L-M- MM͍2FF ɹ\N    \Hm endstream endobj 79 0 obj <> endobj 80 0 obj <> endobj 81 0 obj [0.0] endobj 82 0 obj <> endobj 83 0 obj <> endobj 84 0 obj <>>>/Subtype/Form>>stream H\ID Dy@}kN@^^0AI$h]|-!?߯_O|Yc{:Z/Ixzz'NO.}Lcgz 5~s!?36m8,Ո+2}φtļxTr|g IYg -&Q&ϔ =Kk D%!LAJL >B$WD-i LIx*o=Bp漎=qvCR|2}L=m8RWIrg_fvŌ0<|(p-F وpq C ~" Q"UU*]E(:7,XyF1 ;oR[9d.G>HzDrJ(S$stCUn 2u_cUS?sZN:Dx;Я#k1FQ{a3Jh,bWݞ)H_d?Sφ{( 6*wx|s<0[a<L7žw)Jb 6Ց߶LZ&\D. NgrbDI!vcƬSzNNa_:EA&=$D3Ik)|GG艊Y  d@B=5;ךΑh#L/l.G>DшڼĢ'Bv e#XPJXgI2 Eڌ"4ֆw+}n:6I!;S[sBVwfmB tl(~€FԘl\C±yyH{@7BBCx. W;UCLwc6FqB6[4Z#|Y(0q`\eD/Ua^SYȗ2RyR0jyT> „%eJep#*l|rz2z\H')\x "Ch%˭r_T"v>ʛDYW];UO%(hG3;{S6![֕HkX<-#zO`R?]E9/7h,0"6Fn&S7 zE1q>)C~O*w@2%/2U\̖JԆ*RNpi*GgKo~7ʔ Vq3/sYV5UI I:pPdH}SS\xPAǣ~?N=)AJ_+JQ+d ΁%5TMX5hmB zrY0ѝɌ&"'#66b6bv 7jzTJE -_D+1EFHnҜ#U*Hj:\2ATfZfph%9NO!-1VX)9iOkd&M8SR>UWоk˓9  Qx#0 +Ϟ#K€<Ч˴a3KF%;$tcJCF YA/2o9HZxhH& CfגxRBQ Mqj"8E)p)n4fFٔ|˯hn^(^ }XamiTdjV֣ի#F *!lr."V?\|@u>zI)R8N MJOehg"̀)) xp@mO u;ܧI!MNyM[,q\4b.R u@l|?^ƃłL rw}E.^ +B_1c^n[FI/9D4QuZ4{m/v'X(Dv Ґ]BRݽ[86e|ob[2$.תș04mQtq67*0JHʷg'ƍ C[Юn;I; K[<; 7QG l&:m^,a{yufl+Xcu ZQ$:Lmsn9slȘ6jenoي U0jN/|3&/rU}il  >ʵZz* rWС#t$C|OhR"!&7?ę%#r6gF~rlSչ] EqE_p )_FUCKsp ){Uy=RFN!AICvzKcEJ}X%η h?a8~[PƇQ:fS@7\k`]㦁?O1:h$J(ť()! OG5[1W|yCIok=iKS1fC${i%a#[%w .3uD4ױ‚0Oz,eT'Kq BOXPU`9]~eƥJ^ٛOu$ْ°?LC2ѵo%VUOA5X]_ż2قQy2CӉw\bwzt2M{&tZ=b ́ hк;C.)e 4Z- :7̼YyjvOj܍G< %Ib=*~=[oM{n~f"#F$X|9${;D`?U(+I륅Pf$o!fq%D&d| w;X63UvQO%!>Tp<썊 >(B>@Ƥ~msptױ+,/bThNssC^e!֯4U>JLgEim7װ՜ڣ(ӝCtOøDzu=pX8R=54jZ#Q]KDϺߞve zCN8uȱ K4m#ta=f;RF=yHI'Iqd;5Ѳ?r(>1ޕm%ik3,!(ʇAn1ӵM7ֵ-N:v|eh@2">K{ж'zxPf#o]W&m~2,Em1u{J;2T09 +AQ5v2|F;Sg 5r%jRwZ9Vۦ3|snQ}]eċф4-)4V\c Hk ]scbDc C&hSxcTb3wʡvǴmt+d@зcg\g dMbr?95/׎Mb[UBbͺ]_/'FcXϭ ttQ/fZb=*$]*0b`nFڊ+*h ZeA*t5t} *db5D+͙QBXC"Pe IyCP1b|]i Ze3f3g+7y[M uxxn ʘʩ`΁gU`pUWm`$\t?uU%iRcɒT  \k+ 7}&"5۾m27Au52WXLÓ-?΀6u "^]"K`܎cx}wO>t9JM_?,E\"y/dԋKJBu :բp;Q*aGN03Kw`^GuW"Ix6I (36xWLt_/bblO70]Bee 5'Wݻ wP{37'9^-}]3;4_> t&xaed"ՎvFIȖ=iaRza=Lj6l n=oVzbb/1*> endobj 86 0 obj <> endobj 87 0 obj <> endobj 88 0 obj <>/Shading<>>>/Subtype/Form>>stream H*2PHwR@q  ,̍ -L͍,MM,s"3 3\# ! endstream endobj 89 0 obj <> endobj 90 0 obj <> endobj 91 0 obj <>stream H$RmlSU>WaNXℍ\1˒Ȧ  ZZf-ҖnZ.u!2DĄ *BL[#'y>yW`,L[u:ky l ƌq Uj iC"=ĔǷsUZ'Ao{amRGi1Kڢ inˣ6žm!6K[
!%/4" 2q9#Ս('%cPzE P\C#*c5crfZTT=ewSK3(1tMDTFK vXFI aKhCr2d;ۿ[MfnpзtRTP]9d{>7*6y".JtʌD',}vǥN_]h4Ek֏% SPB=S(vÕ鐔z)GAAcN eBS#)zČ5ב^CҒBuQ4/br:g3ke߇ooܴ&{ 5 Ean)+!>nR$wZWڻ$h"R|N"Ҋ+$:l, IcX#!@r047%ruϩ]GGg )54{tGN.U.]8`]NIΘ: _M² pjL-}o|,F:g>?vzjw~ į+%6rPi!U?V>7vśX؛S .ңf&` qTEQ\$62h$+wYҘ qȫ[ߪlJgjd ^?5MEйqL9dN7iƒ4ăx venO'Ok"'SM,a endstream endobj 92 0 obj <> endobj 93 0 obj <>stream H\j0EY& ?!ci ^A~#]A- Y^;c*H;yj Z = cE6*w۪ Iv'QU ?(9|.d8# 5hK^AnC)oz ߍ!d>ͨI:*QCLh|G٭WߝUƗtc Y䌸e||b>G>3_#_Xe9g."̱>n%?܆Gjپd1&)~K endstream endobj 94 0 obj <>stream H4R}TSew۽EW4Kt X!:i N81ٱfHE=iYJffh3&,A s}~}IB&!HZQgV[-%fsXX9R,C)=Jq**zD( a-Q1|,%sEP**,P2􂦶ʪ7U K ͖ Eg% F8JN|RW0T :-1`E_$X-"Ig)Bfuy`. sEWl( j}u`4rX;$&aD8Aȉ9"&^!4XE&D8!6g20Id䢔&!=%S @R/:[.vt9La}Al O6H6$A@!) 6" HXph 9Ú/G;C44قJ -X%d)-hAH"' @,\T?0IoplL4CEx^>mGFS(43#OO,䰳PCTۏn9LGF l΁c឴شEޑa_>ĩ7}A"Yѽ|^Dq([;T GC@b"sZKI՞+K0\˽]6SB5Z?VVUy{+k~g[՚ǥ/K,X-_[ZUDeq\~cڃ`޾oGCV.xpr@=@]@HC h%KE0>-h!V)`lnp7hi 0H%Ҍ]@uE6 % ͐a120LȄ 0.R 9cVf1u1Uё!nA> endobj 96 0 obj <>stream H\͊0y9_D(<l2v5h8 XT q8ܽF⭳*tzz얯yl;gXpŵ ޽A.z A}w{P`^m*Cn7B#=]7iPi rѮn*bI,9O<#X8f ۅiQE*nn&nn ff'q.~';9aZ8GV6u5w臭K :r;.Y<կ3 endstream endobj 97 0 obj <> endobj 98 0 obj <>stream H,TkTSWNZ5>ګQkVdԱ]b-:XcD<InB$@n{C!RZEVW}L]Vgul㏹t}VŌQywlkVr]njihF+լWu󸹪M?NΙӌѤ-%!5 $'/KT"JsuIYGrů)ZH f/V jJ5_zo*1FljJ5SiZ5V5^"Uo.1c' |s(q?_7O&\A~8'N5p/^ӂIƂ&rXpۡtyi`\ ,y3ͫn)|:@6ji(:q4y'Ow0)a0uf'(!\x{u2HA:- [=AV8΃{`x `(p=C0V> 6-m;z9t,di龪 ۶JD^/_n9yuߵMjjH;h, jaN88G$Bxn0֖3gw"O8 =tlC֧e 'YRKEm0F%P`ˬ܄e 16d)pOѸ 0Im&O=>mPdV )RN> ߂v.C&, 6Jr@EDz+r|% bAL8ZN< @E0D<&Nۺ< N B4v *&4 X@=sCCl fށ6,L0(V\_ +58\"EL6 A>?;(025C_Mċ\X06*YdYwT R^zUkv߇V)g亰9e|9KV[ Gp LІq"&l%'?)?X6WL"kN*YUY43v+Asë٨9SkR [IͻS0ѯ;˺,iM0+>`jyHe>1Zt)0΁AMq(C,&Be{ #hMJ3vG{= R28sYU@ʇÉH=?反%a=.OV)n( G". Hhw}>|Y0o",5~6`{K?Ʊ֑bHt,0''{$DoM>Ur]{GN N.ՋHIp23T8M[>GGyu|N`i0yM]-ۯ }YSi+iq !JYRb,9Z$xk tmcd#?PҤCv2k{k㎟Nv.o(o"]Ύi=!i ʳhjbIw~Ѩїy{iqbd`vGj)NA n\WW`Jto{xdQC@}~w]60B\s|{y/uzr[ZI|-qy{|g}č{{z-%fs2xDTekw|}?a|{{z<MS[hZ"h}E.9;'ys~ysr{٥Ɩ}~wlYX$) {}n+ nKty~~Ñs$vEEEG *  au L& endstream endobj 99 0 obj <> endobj 100 0 obj <>stream H\n0 y _$Vbhb:@/x1E}?qEy*M;BzUMká;p[k8ݪqjdaĮ4Md8nQW\ZsgQ-!~cf46sm_!Uiy">&y,ɨ^`k67 FمF֓DlF}ՎŸ(8sN\xlO^? /[8cỎ)ZFΊS G;/{ < WO}?KO^䟮.luSpѨ舺;Gw|[ g endstream endobj 101 0 obj <> endobj 102 0 obj [1.0 1.0 1.0 1.0] endobj 103 0 obj <> endobj 104 0 obj <>stream AdobedC    u    e4r!15STqAQRas"2BU &3c#$Db %CE'()*6789:FGHIJVWXYZdefghijtuvwxyz?ҩ39p,&*VaM!a Xuf neFW1"bd 7`ȱCs!`1YЧaNMբ9xnz7OYil[5% ~x0~Er5G70b#UQ1: Xp تo =:j/zo.X%*lmF%^z4E}+uH+#M".uǁZ|Hz[N&I˥6b1:j6&=@ro਋ X$D+pΗx9X[Άv}QLx4lz G.͍v "&Uf 8r16-D$O!\վdX$'Kãb|j,=J*Bsp&Wind7n_nJCOW׃—wJ/uUoM0O)ofX8l7yHO!W/%yY h d- ^\7V7#ik /6L7GT]ruF;E %O.ah%֖TlUdvo7x!A'ltJ;38QW={)#E6{/ a~.PhChꍠv;6.PhCh8(m 1m.Y-'8VBY1 S΀ Ipf[h+`.K̄ȭ14WQ\UdX2Uſl 8Nvp 8U9VǞW)ǾAT~<~<#G—wHxR<KtF.acD_0\?LIX=p4a?' KR.cclldUUʉX-'&mŸb.)}kH*y$Ͳ[vK3m@k\T3 jʸ""b䟑ڴJv*=Tj/}:fҫ%auPm*\U|5}at!o'$+9# Z\t}-ESņS r{s!1mDǬv? pQԆ_4CA@xZXkZE6/{۳v2ot6#~Qn y*T_MrHW:*UUM~g1:Ghm8nkOCˀ Ⱦ%JQalБ8m7e|6CUO+\,+C]d~,+Ced$5pv+#Tu^բG6KMTaȺz:y41aŠ9U7S,֋KY/ 1W*&{dM+RG!ecE!OB]leD ʇ[6qPm\l.?mPW}z( T-)Zrdz&|6j%{%&N71zuxLV&&;-T7ń͒5UQUime 6>0W( J#A6qPm\l.cl %A6qPm\l.>1QE҆AOZRGz5wtHPV$X2=ɚ\hi- h.w2"]EqVBc?`Xf&*"wrKJ75 Q"Jri`ď DCQ|2!<Yߋ#um<Yn2̓4?b#UU}BèۺYV]qOO9lEQ|#0jova#\,pEGbimj.1.~efl"f5ޝxz_fMSz9hbPV.ꟈƩ1GEwYz*$cfp. {#(-{>*/@C~oL^Fjذ+ȨBмy[^sƌ;|4\ ; [bh+#1 qoVQ8+B0 .+Ԣ9EnpدV}In3uV#ɷOì'\h iyp4ȞrLH; V+{T͓GqJ{*;̶Qz|x(w& 1 i*bj^^ʰ܍8{ - ) Kyuنn#%j#\euVuLj{OstNGstNGstNN\v,VLD*_71j3DUW*p u=ѳU+pΗxnoY!$M2w"#q3&S9eT, `SQQ|6Z{ֶ;#.~\>?qtU{>)q:)q:)q:)q:)q:)q:)q:?)q:;ZuRގ5\h4͡:*o%X!9SduNrUUqUaLcEu[ XJu'Xq+"DM`ƾVQ/bb/j6Ǚ5Tj*$s9[;5F50|w=Nbs/55C=U0 *NR,Dd6|Er;}Pfs!2+yMW%wf=cQ q a~< b q!t]WuMdۧsk4v]ӆ<o:#`"98/MF @&.L)OX|{"Lݹf.rЧN ;U3})3BFl4C4\ ; [bh|!1N:SՕWyVz+lU];W%:^x(6J y+%fdQUpUBQsw E5c(YdhROV&;0%IR4ja r\0d&Eo1Ǭ%: q(d%Š"h\UL?%8 &p393P r\0d&Eo1Ǭv%BdV+Jzk: q a~< b q!t]WuMIILTc6 nn#ZSݦ>?QLt7oibWdDOTՋ#?NrƄ`mw+zrX鷝 <E5(OR4R3 ٲQ>#2OOOOOOO$V&0ܟ9~2F07̄M+d!A'ltJ;38䤔¦) U?S~~ԤvQ'M_!j,|︋`~ATT?UIKpPxK ~v*c1ܼTWr X8+ƹYȭ pF1U_Bݥ>?QG{M|~,RoI3jSrR,'3Tc2Skw3_?%BdV+Jzk: r\0d&Eo1Ǭv? q a~< b su&Sb9ˆJbZ$/Lp_ '^<qEOT0wB\Z &Tc2S6j%|[Uaq&_ɺ=!TZc;/}d[ VVzz1!51{5hTĵCycłQ'Q(5e\TUB;>fk,R\-#^#ubz9HHTB. :R7; r)۪ ,Hp6+ qCkaj&T6XNrXث 0}FH{b iJ֪n5?Il#|}{6BXJ*CDT! Ǚ)swةb+yrI(UR2UZP;ƨŲn~atGQ7 !8h>rUNAM~vٞ!;3 fx@hm؍|-kp2,v_5k? Z'hV3< ծLv5k? Z'hV3< ծLv wJ Y;OɟNrgxA\d>q5}𕌀2v>yQi]ap.=#˵|HzS~f|bu ۛ7uW]VrFnk:Qltv)B^URBmlDDUZ)EXk(M)5Dr}r,k"95?3ɘpfwJ@ r\0d&Eo1Ǭv?F!h4[Sx3\1Lz =fWžٍ#ƀH?MX /Ce=1_)>fk,R\-#^#?=[&q"+֍_Q$i-_Yvxp5 !MD^)E[|ˡȸW ¸f',Hr J,H.[8`UOGwi"3"Sdb>c*.K̄ȭ14WQ\uGJJ5bIs,tG';S(-آa;ڤtis. ͶѨQ[/  2{FWD{}ó:_qt,:L`L~ ?H4Yb'h/4Q@3-4mWށ2hX;F ~_殴03]#-tGر~SwgI2Iٚ j3(wDצ FBWj-DMII=wރmy,M9 H7WJM=D`Ǡ̦ҙS/j3-4mWlݔ镗˺31]n"zTmmmmmmm q6?LZkUbDOA)SrVƄ*yPo@}6,fMD5n04l6|H{{s0q\3?G9[C!@*/B:Llꮢي>DFzTmmmmmmmm3܍ϐz""2٪"N"LBV*5wȮǬv?NY٘p}D/'#S* jQ Ia,ucaa'Y$?p:!G>N>H~uC|d|#'Y$?p:!G>N>H~uC|d|#<էl7|''m()ĕj9諎sqrW/%yY mNIF+NU-fZEWt̗6RBjxбKײ_W}{#A^Pwײ>|.쏟 }{#A^P@! 8](v̮,=[(RV9W^IY'⨪`#nBׯP 7+Sى8q5vHf6!5J݂$?q:!iE~:A{b9fy vrUQqc^{!r7S`訮O /읎HHhDO~N>H~YȖ:"/#eHDت&y m/jݺ-i7| R\i6 G3mUU|Et6FҚ{q{*L|d|#'Y$?p:!G>N>H~uOcWg7#@ݻj^cSu 9X+q1{Z)oA}4,V%w8#-]f5I۹s QwK ">3Y 6 '׊-}XIk1L0#'Rљ_|FB&WchQhq/ Q1\1_w%Ō|hvg#'Y$?p:!G>N>H~uC|d|ǥ1,*;!X|Iٹq0(.#Fz}g}-A\+ejupCq\:Md4|RrG13EʚWZ$hݥ{GWthݥ{GWthݥ{GWthжμNn??b$D=]juz /KZN&;7"dDj=ZySwnI/FTҢ-\vF{=bعN[ˊΧU{Ok{}6[[^ӫXqZD^T*Q$gl3P-b9'`24e-/i:̱ZꈾDWmebҿe=52 ΍).q4x Eu.YHQq2?(+kLb2 нaZrmܽle-/h-oyo{Fk{}6[[^ә)bL6"y0TaYwAMĎUK7Pzn+eW*~A̧7E3EJ&RȊ(G1b`DnjY>[g4B])ʋ)K?EZ|< sr⫺1Y~3IF3uȇWSm1|x &WchIզ)q$`*Sh{OBk{}6[[^ѶZrmܽle-/h-oyo{O㲔L>;^ʴ+?)UW?\P=}l$4W*o%jS`N+X|Q~鬆 t(9~k1L|7*`7 E1i-4hWlWb3-4mW.JV,LnsU#?}$,8j0P)UU0?IU3+\Wsg,Da>sa*by?5ʞȗa'r Xעn N ECk~o ?.q\:Md4dۦsiGhmxnkOCˀ8Fe~M+3)i]a$DRHGzuJ"-7a5o=vWxFc;YɷOì'\h iyp1_:k!&?sYJﶜ75!JKM#2?F]E{9o ? qh3*WS=NgNrだ覣 e8Z_rtnyo&6+aLcEu]XgTޏCGH2W9W EROu9Ocb [vKY2*`ލjbH m$F>' Cbz3,GqnYN%wN8/1CW>-%*dy:3LUI`2oWh.F3{r WtOQ~j8CGhuTmwꍡ֣Q:qߪ6Z;Odj-c\*͍2晢&jIDtUr[3\>\Ì~=pDU=:Vjʉ/)mPDVS`T2b9jdnYڭn2{kuɓ6[LZrd'mV\=䐹<-&^+%[߳:Lv3b+`64 X$>S,.J? ̿&'ܕ"I'Cڕ1U#{02wB\Z &Tc2S=퍻ŷRpʾD%=/!kc="=U?D6Z;FQ~j8?M>bT|J ~z5ÂigJ#$( W9W S퍬͆j;=jS~/֣͡Q:qߪ6Z;LsJ$(|\wqby찳B芅ZFbgk +ymآ&tOQ~j8CGX\-6i>*6*N*Lx|EIWxFc;Y 2ȎiuisEn( R;!#Rv|^$5+mL6QHMr˻#®+i1 Z80G&=&W'O6VϱhW!Rr}6b-6{TDUsq'b,G﯐&?sYJﶜ75!|[s̞d XNTrb]%~}>94sEN v.77bD:J͍b=cŴVA~Gd<ú;!,?pyatvC;X~żMWCb4(,;uKUpl\\ U`Ú~6H_IثB+ !#.YM~㭍TqaYY5akO_f ٽ{q1eޭ_ZAh`QWse{c, 0k\<_|$ yNvG҃ݑatdx](;6JvG҃ݑatdx](;6JE.;yl, 'BLʄʷ,=|F**|Jaκ3;qYYY],?pyatvC;X~쇖TKñywƅNyv~`ӰyP;1ghgj"zY0YKwxmj3dLU|ju*]d!XTj1q#]Bz<~$+^FTM#$z|GxQKADRXJp@93TB%b'buTEoFY j>bT0ݑatdx](;6JԿ"ʰPZܫ$'.Q7SPQ֝aH'vG6Wf \Mb߂j5!g/ȤW"ECPwzM2rR HHjbmt$H_5pC dp)Rv7&"?rJS GEWئe'zUڅe3zU˼W>LV$F7WDd(o]_!Uֆ1VLLL=^Dv*wΘ&?sYJﶜ75!M 3n0ea5UȊl ƍ `FD7c;~gèł5ss69bE9qUX_Q1GuS;|Q1GuS;|Q1GuS;|Q1GuS;|Q1OZd;_,/"9 M5SNR;jlBSZKC7`U\UlUF"n&WT'6Zn^N78߫;[?~`lӍN78߫~"^届:Sתg+c:"q%*AzSƇKY&݌*V6=+ N77m T>#Ur/ir/iTUfي.(bobN^Ĉ請?wB\Z &Tc2S1X"i)Л0-jawAWir'B`CG?-yLohG-yLohT/;ܿyrUU>^UBH/_:zkթ!k'.+5;|Q1GuS;|Q1O֪ߙq4US=EMa蛇iEnsrV',isUӋG-yLohG ZL_hӋnba~|G;ʺ: t Et=GEEu?Ev86uW}ṭ?.-"/.jc)`7/`ع/ת[*EUDUH{GMe Mw⽫rB Gb\NP1\0 Q3uc Mxf/rB q(d%Š"h\UL?%8 nkbpKݹM %%nWTOy9̲M1CDOޛ!SiSuV=|MC63ت&('9jf'Oy? t Et=GEEu?Ev86uW}ṭ?.bbOIjYmF5 /Uf9 p t4II͚؈`LIgT}>'k>j!_4r?%8 q a~< bʷKFU091B`OY}>E$+O'N9o ? qh3*WS=NgNrだ覣 e8Z_rtnyo&6+aLcEu]XgT t Et=GEEu?Ev86uW}ṭ?.΅g2MF"1#( q(d%Š"h\UL?%8 q]Eb{~/F~(BPaLcEu[ XJu&/SzuʴQLv*WW=N "t5S}$,8j0P)@&Wch@.K̄ȭ14WQ\uG t Et9܄e+51b~O1tݭIqFK ߝl7M76~m|{Y'X{Y'Y@rTlO){pb5p(*-ro3Cˀ} 6a`覣eiFn~w:0G.!g6slʲMgX[:uuuuVA˹̆U ]'q "1>U&W+2jBTW+$5T$dj*v9/qɦbNÜ/ҿrO8 Yw>,㿔uuuuuuuuuuuuuuuuuuk8g߃˲"+yɇg[JPfūBԇN>$ڿ;V[KKU\ٟ=!'']ȆWrR0pUwH~,ݞUrn_u߃vS98"+q2rl=v *j1 r\0d&Eo1Ǭ%:Ue*HWN+7Z煈UnEѾPiEo ׺qT?՜NNNNNNg1O:#]5ҰV7)*S(MZ,'' bE5O1kI,N b|wS O!s<sqݝ U !dM{c BU$9M9]Ev\Ḯ\q/"Y1b'2?x\UR+4:.8)4\ ; [bh+#1 t Etj˨\1C1oj19Q5|JtihSe1n/; p6h݊"og8cg8g26#強$hUZ+B41"΅X ҁ)?LL\.$ sg.Jy1Uz)Å; ]͋\FH*+ v vveg+PâcAkl^G.v}=A ]?S62rrcCԝ#26k+4+(62!Dw1DQ*GT=?ED v v v v v v v v v v v v v v v v v L~>c5W0$*̻HCSo7 H?MXu:)@(rݡ_b&"{wp>@ixz1>oj.7"f$ 36+iG9U0 Y=GtDV87UEb?A\TbS\C\S3{ʾ5>@1+YEErcqIU3+.:"í+&n3ٮ@Rrv%BdV+Jzk: t Et6bE͕W}pJ H+$O,ZI2Gyt,:L`L~ ?Ho#agga6*9nb*ߑ!/p1=m2+aoBjJ,G*n݌dD%8@ q a~< b Ipf[h+`9WNd"QW{tJ൓3Q*#pD1=Sjj1@ 7p?ʼwEu3Epù&+3Ψ4\ ; [bh+#1 t EtɷOì'\h iypt,:L`L~ ?H v ?GS^ Ⱦ q(d%Š"h\UL?%8 q a~< b Ipf[h+`e۬&cE5xi+ $EF,\|uqLl<+wh.w2"]ErWxFc;Yfs!2+yMW%wf=cQ t Et} -UCYΊ|2m95;DisZr\鷝 <E5(OR42pO5ɓLNɓLNɓLNɓLNɓLNɓLNɓLNɓLN s鄢WBznxڧA~оnh2fRLbu>Mbu|_+cwB\Z &Tc2S?Mc)oBz&'Q݃&'Q݃&'Q݃&'Q݃&'Q݃&'Q݃&'Q݃&'Q݃&'Q݃&'Q݃&'Q݃&'Q݃&'Q݃&'Q݇)ß-fjӋ)XU1Ir]i!ЙjaKL= 8Fe~} >Uy%:mwa2sw`2sw`2swat>';W+U#/e3z)M]fLNC$0ܼU>&Nq1:&Nq1:&Nq1:&Nq1:?NM1:8I|obEL}&eUnF+1) #7aUOykUꈉ!2sw`2swa.N6ñy> 쒉j]]XgT.K̄ȭ14WQ\uG t EtX9TJLUʈ^>Oy ҧi rueYKlHhحȅQU;WuɷOì'\h iypt,:L`l)7V'1ʛ(Oq{QŕywÄDUUWƪdVKЃkt d]6Y.*B VKЃkt d]6Y.*BZFl a5!1QB2͗Ɖ),}UFI_? RQFy1x:dgDHq#DDsUI qPmr\T.>QsH );)-Bb/ ̻q@30qU3̔siOL2 Sr ERZQQ$#@jC[:mVKЃkt d]6Y.*B VKЃkt d]6Y.*B VKЃkt d]6Y.*B VKЃkt!􅓕P[nEXp=e;ekWkUj/*l"%%~N&ohp5[بC  ]]~j Ag5vHdI $Їkt d]6Y.*B~.*"|$ą,ܽJ]ƘTpK*$=M]f&L"޽FͿSKdKel5 !~NEPr\T.\ +%BCdʐoy[[;HX5S ݯS!b☝/Lw}O5 ˸4iۘzI.O jpkyydfNVKbt!d]{kpF4|$0B2eecVB$H{"* Yg7#hh.w2"]ErWxFc;Y t EtFdPmG0R)R6ќ֦;n"sEoG-zYGm`* UYȆt_l0Z?skUED u`H?MXu:) H}{s#bATIL$ce\arwuE-'wXm\arwuE-'wXa"% q2*\wT؋{64({%jK*V]5TuCh;oeh\|]za^>g$b.8{ .30qU3̔{ jHEK`9xѮM9֢`Qm! >RV"ClSm\arwuE-'wXm\arwuE-'wXm\arwuE-'wXm\arwuE^NkPQ9޽VZC|U}vL:4GD{N8Fe~ Ej3`r!HJ5AEU\#,*L:V+b7}O *aƒE3 eh3u W/HE05#^V̫Ŏ$r{U_~@3Epù&+3Ψ t Et>\:T"Vwiw~+:jq> 櫈H?MXu:)@. KR3wΠYVs y΄xQKADRXJp@> M?rUUqU?}KĚsyuc"TNZz"bCP)rFn^?'H̷ѴWQ^]'j4{5N69Sm_uvbib+L1|Hs?}|l˼!s"ITr0ړFj&LXT>aLcEu]XgT t Et=GEEu?Ev8o:!`XHSQEG@WMwtJ&!,Hq9x쯦-O+``wB\Z &Tc2Ssr̜ ^E|JfEbrw+ kخ~ݓf-`djL9wwWsYiV7jnjMLpE`DԚ=핂Dj.T&u@aLcEu]XgT t Et=GEEu?Ev8.Bfa=Ŋ$+W覢7 ʾ*q\:Md4s2f4T*{?pu3Da覢o 7Eud鷝 <E5(OR4R\i6+{+ÒSD1bMљ<`QܨB4\ ; [bh+#13Epù&+3Ψ t Et=JT"Tgiw~?Ev2]bj)+"Fzz9&ڵ_Fѻ[TmzuFѻ[TmzuFѻ[TmzuFѻ[TAA6"yhnV*5!Q6Xsʪ``̓Tr{ \h? 'wu*$%ɈjO)N+X|Q~鬆:"OqHkG]fZQO.at ]1r uO%SSUЦ,ܝbe\41.jAO*5;/ǁBY+V}6UZo&>LOert6;.OV?yZz U2j!@|/Lfs!2+yMW%wf=cPh.w2"]ErWxFc;Y t Et$]} p=RL#ZzZ~9ʫKlɶX' XMTDx2d$.;.6G҃M!tdx](;2J6G҃M!tdx](z:fRVB1b|,$wB\Z &Tc2Sc2܈lNVjV byWG͑{ֱcC64ٰjyvnh=C[讳 } 6a`覣eiF32Nk{X> l7f.jxɖDTOC~Ac)b"*-ogbh"@;|8j"z~nb5UXx<1y9%e=ꨫfƄXKC#URJ~6G҃M!tdx](;2J6G҃M!tdx](;2J6G҃M!tdx](|c_-lt^ n#CZ(vz b@T5صWA9!91<׸g01.-€%z#LJnث@d4b| pP߸? O@,2oFqrn"a^22fw4\ ; [bh+#13Epù&+3Ψ t Et׫Qp]DߓhSQ6[79wIWGt~YڿwIWGt~YڿwIWGt~YڿwIWOJN2`OLGujwT#SҚe+{$Qb̫2[0pv`W@W/%yY r+0ߤ&e'_͕+I=vr"ċ9}>$@s2f4T*{? ux%r,l=.0fYCv OW2pu3Da覢o 7Eud鷝 <E5(OR4 u$1X" =)+ w1r0oUUv톷\l5a/wAk݂ wYuK@te<"9𪓰>x{Rudޜ_{J,_;J,_;J,_;J,_;J,_;鶚ܜ_vRJ~N~2R1XOP[[䞵-b׮⩄=qUU? ^xD96 Hm*k'rt 뗻.PcQl6:F:3'2\fs!2+yMW%wf=cPh.w2"]ErWxFc;Y t EtY< E',>cn ^tC@+͢i)G#hs2f4T*{? u=sU+pΗxށ2mX1k}4at,:L`L~ ?H?8ok\vXDj5~uIը[?I̴'P"Â*y5;/ǁBfs!2+yMW%wf=cPh.w2"]ErWxFc;Y t EtY< E',>cn ^tC@+͢i)G#hs2f4T*{? u=ѳU+pΗxށ2mX1k}4at,:L`L~ ?H 9pr"# *ah"']hmkSW dCj|D0@kw3_?%BdV+Jzk: r\0d&Eo1Ǭv? t EtY< E',>cn ^tC@+͢i)G#hs2f4T*{? u=ѳU+pΗxށ2mX1k}4at,:L`L~ ?H Ipf[h+`o@}63Da5n0!@3Epù&+3Ψ4\ ; [bh+#1 t EtY< E',>cn ^tC@+͢i)G#hs2f4T*{? u=ѳU+pΗxށ2mX1k}4at,:L`L~ ?H;nL6Up+!YjmrcO|Ŏyσǻx?+{ǻGZ+ʸ၊oLdxqqFnnHڻ|\(5>I}I%=X<=X<=X<=X<=X<=X<=X<=X<=X<="v c埃f#܍r).KRv*۸+ԇҺ"kw3_?%%~*CW X]H6Alf1b37 >|wc~|=X<=UԺ:;{7E;a$$eUDEOAP5u@aLcEu]XgT t EtY< E',>cn ^tC@+͢i)G#hn(̓Sz|HJVYQLv++ʦʜc)w_I5]}ǎ#/e3z)M]fAmBìMF@r1t&;r//bkJ G҃ltJe}e( qV\e #xbCW@KKϱ&)c;mػ JصJ G҃lt?dx](6>J G҃lt?dx](6>J G҃lt?dx](6>J G҃lt?dx](6>J G҇TFPc,W|faT!m[Q%JEOӼTMz1hgM\\ǘ׸g01 ɮ 7MakM.X-@k``G Kh2fď qU7v>J G҃ltӲtFDžB_U&ɾUQSSoG9ʽ*q3Epù&+3Ψ t EtY< E',>cn ^tC@+͢i)G#hT>3Qz$w$r{d;$^ftvnh=C[讳 } 6a`覣eiF7Q)I/uu[´&joDL*QQ*>5wJFңQteS8ˆ*SxT{Tj7绥GƣyQ{T|j7绥GƣyQ{T|j7绥GƣyQ{T|j7绥GƣySqz#}74EXO])o=*b**|q&p393P=6Q.=w]F]QlJtjV=Z>vb"W*FңQto=*>3wJ{. 9#.K̄ȭ14WQ\uG t EtY< E',>cn ^tC@+͢i)G#h6j%{8F_Mf0SQ o2΅X ҁ),ݍڷdl7ʸ".f4\W>>;ьEW9pDC4Y{TձpW ^U)p"5wp q a~< bP@O:h7/5MM&(CU$Oܞ%BdV+Jzk: t EtY< E',>cn ^tC@+͢i)G#h6j%{8F_Mf0SQ o2΅X ҁ)).q4x Eupu3Da覢o 7Eud^x(h.w2"]ErWxFc;Yfs!2+yMW%wf=cQ t EtY< E',>cn ^tC@+͢i)G#hn*T-\O"7^)-=#1[<|P[OYorvnh=C[讳 } 6a`覣 /L fBT!HXb*""&|[KAQf;*~2F;3 fx8y٨pRsXV`LH%?.Xb.8)8Fe~X{ۙKCsʉg♬J2fn. fHՀhmZ,;*"'j쀬WC6ٞ!;3!,F4*-c/ j͘d DMEWtĩQkSURwu]0MT!}CP"EUlG*zN!B^y`PuWxD(^{<"/=U  wU{B绪 ULhRDsU]¬=&+U'i@>fk,R\-#^#W/8%ߠ[kiB~bT\pIJ3((&W~  wU{2V } s`[WO2]O5{!B^ya!(ջ7oy+v*ot=c+R\i6+sr/C\B2%]Pz/BpRViѡQ7+EY+"*>$U:O wU{B绪!B^]Vќ&~Ry&b+U\~#/e3z)M]f!k"I™sUv?b)4ԅrolXBFUٻ!B^y`PuWOJGbRޔ=ʨU┯ƵVj;ܪv>_MeX t]Dq1_:k!=SR&O]E:H=];]!I63q̔e۬&cE5xi+ H?MXu:)@(r?'H̷ѴWQ^7T_+ZHNrGf*/]gJvnh=C[讳 8]2@ly57Jt,EPfs!2+yMW%wf=cPh.w2"]ErWxFc;Y t EtB &ܵvJUu_W磽w#ާ\id34YdvEA\>(Hk f/uN+X|Q~鬆wB\Z &Tc2Svnh=C[讳 } 6a`覣eiFK|$ EO9LzFUT.K̄ƭ'MkiBc?ZX8F_Mf0SQ o2 q a~< b4\ ; [bh+#13Epù&+3Ψ Jb?Іs"ٲբ}XB^ENs8F_Mf0SQ o2΅X ҁ)IǛr6ʾDtۨUfHEr/;666'_J9VU v0vP.K̄ȭ14WQ\u@ H˃;hVn1dUOCw'Yz;HEy$^~Q)a4D줋> |h!-"iu-g*$)hk)N"w'Yz~eJEOIǖ\"1L0!Aϑܭv(9w'Yz;HE?e+) b;+H/o;UQPfs!2+yMW%wf=cPh.w2"]ErWxFc;Y:-`JBsˆq߃nQ. Pr'^ #CƈvI!![>d.?嬗 yk%BAZyw^d.嬗 yk%BAZyw^d.嬗 yk%BAZyw^d.嬗 yk%BAZyw^d.嬗 yk%BAZyw^d.嬗 yk%BAZyw^d.嬗 yk%BAZyw^d.嬗 yk%BAZyw^d.嬗 yk%BAZyw^d.嬗 yk%BAZyw^d.嬗 yk%BAZyw^d.嬗 yk%BAZyw^d.嬗 yk%BAZyw^d.嬗 lYY g,(0s"#USke~д&X}&8B/%e+9.&bbTBrQȺhdaTpqeOsFl):Ǒ6n>#z!emeBʉ^J`IBCEr.BsVX)  ' ~uzd|>+deX5qM^EȌ٣U!]vګK1v)b8_aEpJ tW}+0XK2ىls(B2vVMDmr*"a\SN芬pg;G!.-aEJ랕3QUXeXV9kWuRλY/2BK̅ЇnZWuNMa |HRMG|jr1o@}6,fMD5n0o:`W) ҁ)RjT!jQ7 {!*sdOU!Q!1!$%b?DFF2Un"u~nr&>2mɞ;>DG=RGw^d.嬗 {HIX'feb9RpE!P4i,q<h.w2"]ErWxFc;Yfs!2+yMW%wf=cQѣdmND6!%MAՊɼIF\ԃ46+["o3ĞSa>#qTEMz 'اOqM'o-F[i7/썼ӊo_ymh6N)dm嶜S}n\ u>xwc-z~6N)dm嶜S}m8EqM#o-F[i7/썼ӊo_ymh6N)d\ urZr&'Y{[g7/ͼӊo_ymh6N)dm嶜S}m8EqM#o-F[i7/썼ӊo_ymh6N)dm嶜S}m8EqM#o-F[i7/썼ӊo_ymh6N)dm嶜S}m8EqM#o-F[i7/썼ӊo_ymh6N)d&\ u>%CN=ϊo_y&6k'xjHHEU#բW_?52˹yp3p_JOtWQ\s]7kS "Iuzn5q/CNb*|˹U!n*c $y&ZpMfEkL|QemF+c$([%t){|?e-/h-oo{O#hoZjɹ9ɹc5UrN+X|Q~鬆j; 6&] ;y]DzVv*CjQ/"8#Z~*'wB\Z &]R,V"*E$ʾY8-/ 50jqN)dm嶜S}m8EmeN.5ʫqȪ\WuTvnh=C[讳 ~9IՁg)M1%l5b1q_F: e}A(v%\ef'^]OtD ت⻜ۆ~S햷ܽl:Pvީ aŝ\sq5 R2ƘzS3Epù&+3ΨXنJD~]h6;/ ;d&:"`Ɩ{O8%%v #߂LuqM'o-F[i7/˚'}fV˺ eFۛU?SQXw\l=,O ˊٱ _?[ymh6N)delf929U=rq\} C^x\vjlX ET\wWJSrӵI&ï읆[i7/썼ӊo_ %_&EޅWR+]:Ws4\ ; [bh+#13Epù&+3Ψ҈lԦY b5J]UFX\ڽFrW*emW9wkTHP0sO:,Y8Objc<ErsRnd/9#"VZ~΢Z@ t˅z1;;v[]֟܇51r!lY:TYg(0v;E1W71Q6U\jx~u+Κh%~Oʩ-ILz/r#nUWwB\Z &V\gckS;zYc4Lj!tWY@$GD]?N̞)v9ej1 o r\0d&Eo1ǬvÈN&UW.* q a~< b4\ ; [bh+#13Epù&+3Ψ6VkpE&eyv.\\p#Zʨ*N `r2PCnQ1rJ620MD{IBY)軛-ѼeKϥP6]b /Qf)@GTdޏ'8%R 7{ q!t]WuMdۧsk4v]ӆ<o:5wsGU <ˣ:+#',>cn ^tC@+͢i)G#hs2f4T*{?pKFC{\kM]f׸g01 .K̄ȭ14WQ\u@ q a~< b4\ ; [bh+#13Epù&+3ΨԎT J:sq_WS}J*qSy_MeY c:#%.S]D vC_!#"VZ~΢Z@ t:buf+p֟܇AmBìMF@W/%yY 6RxQKADRXJp@“g RhI[KCjĄtyCʋ^x(h.w2"]ErWxFc;Y&p393P r\0d&Eo1Ǭv%BdV+Jzk:Ն n/ @3\*""&*"@a3$r"'3jU&OyTmjۈa꽝VLCVWYcVG!h<κ9rr1#!5\C)S:T|497l7TSW,N=Y5 Zy spywqWQW d =u֎&2rzypS_GfVCt'l\)HpbE\^d;[+XWs1N.һzݦ>?QG{M|~vE7;owg(wiϏSyiSoS54,VN$WQ}(|̇ M&2Bʕ:d&+|HVUMGK?)S%kv-Iڭn2{kuɓfɒHNE|I})Tf̳c)Ws]7kSnYN%wNH?MXu:)@(r1#UU~\UOJ?)"Yhc)i0QruIO`:z^|1gYAQ=%]ioF5`O/˛@(wT7 +D/T5VN,g9qU '}b)QW@9o ? qh3*WS=N XFs|zں4s[bHoVDn 9XTҡhc|^1wNUuJR'iԣUɉ,5)Et?]T=L\?࣓-'mV\=jU&Oxڭn2{kuɓ6[L[FOVBkaSK)`~,(lWrb5hq_26d뉹{gl6lb`y z9Q!*ƺ"#p*zzmgbM0Z Kqy5ofq wYVE?U! Սb&: >8l{#Aw>l>l{#AŻ#0Ŷl7#Y BNֽ֮]Ÿ xt V !#_KL7Zv|J LUʈ]&GJVBT ZX $Cn=(>EDX~쇖zX;Xx/1_fޥA[r.H3/Hwʽ*|2m95;DisZr\鷝 <E5(OR4m>F-F;aCLUˁm#R\Pf.u6߃݊o"U9HJ>QGeX](|6.6JWVRM|4 5w1BrkéDY}]0Щhj8+v۞_)y7o}66ҙ.Aj""`lmatnQEC&'c_ՕR/Rv$7#B qF k_ŐU+Gd4Ԡ˧r!HW f)tQňEDan$<\eZXt5R,?qyatvC;X~쇖wGd<ǪeXe)Т:/ 3&m X2lvKCP}N ) e;".>bM$FxFjyatvC;X~쇖wGd<ú;!,?qqd)1VyPb^%nȻʅ,5'긯Kp읏ɥkTǛЅwGd<ú;!,?pyatvC;X~쇖wGd<ú;!,?pyatvC;X~~Y5~a Sj)uHrLGq qb|+S5;/ǁBC(Als7Oc,!쑉CZi1:~쇖wGd<ú;!;?n,&3**,Kײ$ٹyPoME/fs!2+yMW%wf=cQ׆tH?{VWStq]q!w|?8߫;[?~`lӍ[VO\tXݾTLz>{WȨeY f@]DWy e\s֊*D~S{YfO6-Bt%pE9yIi(N26& \5[HW-N6߂{~ go?djq'+QU33)(ɷOì'\h iypt,:L`L~ ?H%Jyq#71Ȼ4oH9Ek 6]VTR#,8-r^Vb,IUL閩8:?)q:?M;~+םq\?}Uy"r2Mhgv8wv8wv1c7ꫬUz;zթsXcs 1SsUITE\KdNH#%ޭd֯twDl%UOI'Pe+{kѵrm¨jsއ3N7+d˔e>m!:.QSSwi^߂{~ go>^M7cS;;T9]"WƧB;Kr:^+Lc|v,FD'i^߂{_ O7V%B*lWq-5\~alӍN7ŽdjqW5;[XS/tpfbKd`SHM5~+R2hrQnuj֮̽ct p YM2tF +6brGSBF1."be ?v5cQ1FnM3=G*{πM~g1:Ghm8nkOCˀ} 6a`覣eiFb&2 7.&\Na٨DTUbQrUUqUSOz =fWٝ/hn^"pOzKad]e`I˻cr%cNDHpX|MEU>J'$"M1ZTj&(ٛ\t'2nyNSҗP|x׸g01 7Er5,TgnLQ0U1F梳zfs!2+yMW%wf=cQцtH9{<LX{]?AC_`&"@$-瑹Q'-wERf/Iu t:buf+p֟܇kEә3>&+ro-NBj51MdEs2f4T*{? qPEV1E订gn֧&?sYJﶜ75!>~yа0tSQ2P4#@2Hxy'U2{FWD{}ó:_q$B¬m5oAM{fs ga2%avME2kLkdb`5u]XgT.K̄ȭ14WQ\uG҆tH9{<LX{]?AC_`&"@$-瑹Q'-wERf/Iu t:buf+p֟܇~u+Κh q(d%Š"h\UL?%8 8B/%e+9.wPmv>Bsjʻwm7ksZr\1tXHD} }TG,E#W/%yY z =fWٝ/o:`x&j0&P?Jܤh3-4mW=pX/%~?G5;/ǁBfs!2+yMW%wf=cPh.w2"]ErWxFc;YӆtH9{<LXWx4'W+-"f .LI9r)e.Q1 r[_GB6УiMt(Sm= 6OGB6УiMt)0,nL6Pa2"E!Rtԙd}jHɞ-;"⾞c .EV)Mdum_Чdm)(}LLWV5"LK=z,9By5rpd]+k4YɷOì'\h iyp&&l;TfR_! -6Du1"*nc-g& &c(_ߜFĤ Md9c#Z"Vr>^1gfXlI|Nz;{@{Oqi==ǿx=zO9.Fܷ"aD{8s̻teTR}Iʞ8d=GEEu?Ev8NZԒ?y-؉ȗ/sج×$rlމE֥J~; wUr<srvc'U5V;1>i==ǿx=<{T;wc6ooC$G&)&G%Ajn!KUCY,>c{H=Si%s f̆5bqvLj;[Q\ȎlL ? 8Fe~h2cRT]JXLsX<rO*UyP 7oK$Q1=իFJ˾"TJGυ҃tV;=WƞB29;iUQӅ҇-Y9~t>FMDEJM%|2Ml*bn(zcDlZӚCvI_A=W#}/lը˛(J|M5bPzNZƘvWC˔R D<~u贚8TWovYN*L!6<$ƆsP\J 6KBAr](6.Q %!tcdD.?lȱq.>Yu+;l1 %!tcdD.ll(҃mPm\J 6KBCܮ,ߌBC7%5WP=(GK#UTM-u7GuUQ|!MƞdQQ^-+)fUBf5oTH z*}mꪫJKM#2?F]E{ r8UGTlq+c,k\|.쏟 }{#A^Pwײ>|.쏟 }{#CvPV>L|7 SVI"#6KE밲RV']$zlKSb}/b#Q0NU'wA+-?E]EqQtݭN r /ۂW5d;j 6㋓e,v(Q^ƣ(1UvI]'GQHWu9Ę UrQf*SkXz ]jqHrOETWsҧUW|9Gb\/TfhQ@@).q4x Eu3mEX5ro!: M}aZYYs]Hn㇠~+z?<0y0]C b7mrblaty!6bV>SV#UOyFMDEJM%|Idx^[M ۢAhbd'uTc9wU= zM|{ Yi:.+:jqN+X|Q~鬆}eg Q7sozY΄5[ S9lj^tG*>$q0w9?if>RѮf-Yz" q3梷'N kw3_?R\i6+fs!2+yMWo&=c){/_J~ -g$bɇ`v&Hʾd,HL˸Sh&b:$G+UwTF958%BdV+Jzk:׆tH9{<LX=$Y% ~(Ɯ_# rR 6I*m 6Z^a x1tݭN <7:j$Ⱥ*W,i.zK#hXf^;GSvC_!#"VZ~΢Z@1_:k!*IGU9H[ӴK7̄M+d5;/ǁB).q4x Eu3Epù&+̔=pX/%~?Gt%hQMF.&~,Ԥ4r`3]ت}X4ݖ nj} B@fs!2+yMW%wf=cQІtH9{<LX=$XՑZ(F; =wA+-?E]EqQtݭN <7:j$Ⱥ*W,i.zK#hXf^;GSvC_!ϴh7(9;|9;-6m7a|'MTC3p_JOtWQ\s]7kS1^ca*tO'axHRHb& w,X|S~U/:k!30qU3̔&+0jyͣ?R\i6+fs!2+yMWo&=c){/_J~ ,j1nP=$" 7p?ʼwEu r\0d&Eo1Ǭv?цtH9{<LX=$XՑZ(F; =t?d?{kXT-j;(4&f\7qCY4\BͣOCAvh}6>Mir' [.\M'ɡ ;d4>Gl&Ѓhm|Bd;d[4t<|LIlXpzy {r˷2UɹrB r /ۂW5{dfmATM.yB9=Vy Qn+ +qB Cl(֮(xQKADR*_FO;W%&:zNUۛ/JYF'ɡ ;d4>Gl&І$ Iu0*줍|8M]1053dlUwRj<ElU1пKW~!&m|B OCAvh}6>M'ɡ ;d4>>2jЄy,{9@8PZ!NjKY>Jګs).q4x Eu3̶ZrgVKĕ{ɎĀT#z7%>zNUۛ/JYf'ɡ ;d4>=-ȦD4jmfZ֣W{/!}Vl<0 H:)Ź@f /.&*LwE ̈́nॏMK5f`' 6Їhm|BI܈,8J-{ȄXa#X_UvKGs)wg{}1WQ^ bUU\uK!S#\*U_5ŐEQ:v>M'ɡ ;d4>Gl&Ѓhm|B OCAvh}dR\Ce/tR7!$$j7baDշ#x;Y՟҆tH9{<LX=$XՑZ(F; =} 1.&+鳷IM*g%J!Hgo/;*U?>i/2'UGZK̉Q"uTF ʗzDj/`߿KC%ґ6JBԫ35W*zk9]} {WuP[V;ě[JF{v{=*EFOq.htYeḎҨ{sYLY[/-Lkn+2/)ܬ ޒ:Vn*@I'Σ6⨻ŵ\Sv:Sa@Hj& r}dy+Ar}d?I%]}(v>SdS*JͼC d9\>XYu/G$=ӗ."JJcINv%U/v|7}uHת.;! [[Crn|nYrʲs˂MCClݠn q6I|DF мԙw=#-̼`rŨLfU=ͅ)0ذe_AHl\ch;ozWbw`!6۹}qcܸ)bLDΧ=GEEu?Ev8˲裱\KʺuR bMD<z &b}ftcO-%DIy:<"^dN-%DIy:<"^dNѿzZbEEL{zZKs,YD|60ˇQUf10|G*p~u+Κh&HPeenc.*z-oHDT9|ofM#ܒ577̄M+$+"LQ".w]X( ئS0xEȝUi/2'UGZK̉S^[lic=;wOGthWˊ@,gɋЬG1~ Et^(pڭj*y Y|h˽G4V` ߄+ +\"JB'UOτZK̉Q"uT_OY$:<"^dN鿄bMȽU<# G@u0k+^Rvꪪ7p<8Fe~:0p9VΥ*"*'6ΤfqR|~X) CzlS Ʃ"^dN[09xrNF N2rp@]wAMF-6Q% [616Hq,!7Wq7E,z$MpO"Nr'UODŽZK̉Q"uTF"21VDH}?z'r" A@^s; 3fjYݖc,*OҌoMa2ZK̉Q"uTxEȝUi/2'UGZK̉Q"uTxEȝUi/2'UO? UcN=B8+I?ӆtH9{<LX=$XՑZ(F; =ZE98#ުLwΚ) ,UNDW. ,5j2V5$byT=ĵV(c:#U0ESs]SBKV&q{ Yi:.+:jq9Rsob|&"M=__q\:Md4'-Z|2}2+订s2f4TJ;;Y׀XK3Yȅ!#bУ9E叕|휥|B>j`$V+SLEtXUUW*u`ZbR\i6+ UUDC;((D [mI-o$0,-OMlHUL˸SLhϘ{+UwO&Wch޸W~@ʓ= |CX1*?ԆtH9{<LX=$XՑZ(F; =ix+1Ed$%LhD\0DC_=:6v 8i"/aP 5h-/rIK;q#YLS #y&;rxa6iw+.v]!bEk+LH d4~S\c62Gr#S q!t]WuM',>cn ^tC@+͢i)G#hs2f4T*{?ʣ?n,MCc 7Mn5^fTDr#*'婳Rb#v8"5?Gi/xpaR>R\i6+훣|P+#upĘVz6~¢GUM\&u E5( DBn} 5pa'kq^?^s; Eډ&*JKYW; ;}H][j6~:'gVՆtH9{<LX=$X͑r| Eku#ͦPYcVch)__2m95;DisZr\1_/:k!%u6fAȩS^=hqO:3p_JOtWQ\s]7kSW/%yY 6RxQKADRXJp@ށ2m,fk}4at,:L`L~ ?H ?pR8b)G_7q?I`_ĕx=Xp$bܠ3hzHE>sw E5g(^s;T]Ev4\ ; [bh+#1ֆtH9{<LX]V/ɬrTI }s`0YEnXo*ﶴ[FkEjyZ+UѤ܈C&VFbSp9k,f9>N~# L z);#YAlh2^o9/1cuw_1;E n7QGpCz!S&E:$`=STVnYN%wNiɪ%a$XZUL̚Ӛ5Cr5?Mjc5Uv*/jJ֠>}AkU\<]+DAnO!~Q>X~~7Gqw*D|DfŮH5 *5qCD;r/0F^' w +xv ,5 q=]+mR=[/;)-I[5y Qd|]{Y2BG̅ЃE!t Qd|];Y2BG̅Їj,pd>#= P{ȅeޕHD{pL1B')$"d* ;=yZU0"u}~WEXJvOٺLVT.HSv"y \mBȣQ1?_(,?qQ*9R"kqw)G4kRd., z#BAޢw>d., tMTFCB?[߄(kڸe1| TxzSq:™NTdinCkaÞC,.L:ʵ ȇuY_ z#BAޢ,]:0j&1%dގDvx ]mILz< Eu30qU3̔v4Tn̑<֤TUD\5萒$ЇQd|];Y2BG̅Ї.Bl oBr.{BR̉ kW{! O@ 00o:`U>I rJ yo6lKޤe,gClN$CLU\?JOJڕM|WyLK6Qd|];Y2Bź#ЅЄW+;MR& B-6rz"dx`sw= I_A)T" [ I#sU(Rr1r#$_uMvv UUQ1U3_z#BCSdQ~.=V:WCbi?%2G5]C ўnf"d!NN(^ mSՅ !*v>Uj|1|d|#=X CD R]SOU:KER*\Ba·nyWQwQ Cs$QZ{Rqm)[wb=}u{഑M;Pܨ"x#h.w2"]ErWxFc;YцtH9{<LXg+!vZZlۡ/rVmQ&1Zjc<fzCVc|@=M_1Qg ,w_=}rmznJ,ՑCpB)Y4~_?/Vi&lOB9i.8 r /ۂW5JhJe+H+7̄M+d{1wU\l?BֵY}aó"+"& |oRBLޒS b.;#[;@G0]h6fzL2k '}^!*+c~@8Øx?+{ǻx?+{ǻx?+{ǻx?+{ ;wlrpLٸfUMyms9&ԧ}(06 ꧕~4?+{ǻx?+{ǻx?+{ǻx?+{ǻx?+{ǻx?+{ǻx?+{ǻ6 Zf EjUΈVw | ._c,eN!S!=QpjyWIV ݊*z4@ UHꘪdi訪l]z9RbO!B|%ȨgNrだ覣 e8Z_rtI ^t$Mฺ*WTou>`HP֦*X7#j\=\Z{VMfp1k ~.K̄ȭ14WQ\u@aLcEu]XgTՆtHC{p%}Z4J쓬mB00o2%x6B1j&G·҇׍dU>>1b aBC+ΰhWU:p{+ÒSD1iO5j56F$V2v|^C[ ;K[% rŎ>"4⸟KkH{،PUu<H[#sNZ >YvŪIuY*RlU!. En.s1UTU&|k#CAP-Y>>#.Pf)Xذw 8˺ؑ r`V8uy8g7hkxbkMO:jl0UU`v-T^bo2Ӿ#䣥"+WqgNr;FT0DkqrI ^t$Mฺ*WTou>`' pG&&ɷUwV:YƧ#7UpіQ+1i,kފ&fj"S N83Epù&+3Ψ4\ ; [bh+#1ֆtH?{Vל%j*FhiSpQ}%B?]NTڙW"~*Ol64]t@X,j$̟yf谖 &N$Ұ? ]+UUqS͵fIWqnkn7vQx By5rpd]+$YyVw^Ws)iЏQ}%B?]Niն#&jn=ʩt@*' fo Mi@?L]}$e[Rpع$fk,R\-#^#1A2 ǕZu3\ i6Rџ<>yr6.DYr* uj0%ĵJUTR xYwo*|wDHkQWq=&lWSOƣyQ{T|j7绥GƣyQ{T|j7?1r>'SxT{Tj7绥GƣyQ{T|j7绥GƣyQ{T|j7绥GƣyQ{T|j7绥GƣyS~ObEʜ}>5wJL7z#әv6MvV*/޻$m |gCn-JFGn#MDz\ʫyr˃<-b+|j*u:0$. yБ6ۂ]QJ욧֗33wIm/NElw3 &ӱf,Hsfs!2+yMW%wf=cPh.w2"]ErWxFc;Y׆tH;{<`^"!oG> Ȩ̊tv”jˢaj}V%?#s'c= /0nu 験"\_πn[3v]v&;Je~_QUwbH34]&{ Yi:.+:jq2m95;DisZr\UIKpPxK ?4WWQ_w_I5]}ǎ?p3EU]CP lDU1:I ^t$Mฺ*WTou>`nyo&6+fs!2+yMW%wf=cPh.w2"]ErWxFc;YІtH9{<LX,G K* ? ]֦6V%?#s'c= /0nu 験"\_πn[3v]v&%.S]D W _JLZt]W4uMdۧsk4v]ӆ<4Yb'h/4Q@+͢i)G#h6j%{@doLQDT'heZTq&*X6+ĠhHmqtTM|$*pLmWh%BdV+Jzk: r\0d&Eo1Ǭv?цtH9{<LX,? K+7D1tSZH.':$D' ="Wx>'$< n$By5rpd]+k4Y2CXy>t$'T[^O:\b%=pm@jo=(ԾR#q)*-OݭNM~g1:Ghm8nkOCˀYʳI5)bx./Iu'&Jx6+z =fWٝ/;zYc4Lj!tWY@# q"-FEJGswg{}1WQ]4\ ; [bh+#13Epù&+3Ψ҆tH9{<LX,? K+7D1tSZM|NrO"Bxѥֳ7Lo^%fgTOAd,, T}Y)vFVbwMc$D'IEe t'ԭkgwo0>;5\*""n" s ԭ>z}&Yub\>6/Hub\>6/Hub\>6/Hub\>6/I fQbzEuqnF;b*@M~YK}!BtgZrQ|69_gǜx:zGx:zLt"pO.Sc+QU9wp:`n׍6U."o j2񹇽ą"ٗBWc\ dl}Sb\n!9')90blq"\k-M.n1v6 X};:5uW3#5u JKޭeRrCEM7'ڋwS~pؽ'VlEq2=7I/MTn$F!; ˨c9UU\}TV/$_kP畿7Q'FoQnFoQnFoQnFoQn$myj(21^cw{~JncØTjZi[7'aaCEꋂ>hݭӪ6=:hݭӪ6=:hݭӪ6=:hݭӪ6=:-djcLmrc%nL½2m_Q!! bE"&zWKYZ籪LU~MvN7k|ꍣvN7k|ꍣvN7k|ꟗd;kM:kldU0wS2$U.DB[C֫=헻KAk#$|x)+,BV5Մ3\"ǍFu17?|l^|l^|l^|l^|l^|l^|l^ZRK+bLwTIJ3@e۬&cE5xi+jڌ)(k,Ey6/IS&)R"^Oط+<{|ծLdZScEp/-k'nCj3#e;/f ȺE@b9HyeK]xm7 maLcEu]XgT.K̄ȭ14WQ\uGӆtH9{<LX,dDXrNvJZ舟7Ƥ+ٸs؏Tئ:^zV ")۲j.o/v9`YldxvSSӲmCC۫dT._VzR0&!U5-UئhT:)bWa[Qd&a&.U nP6.U nP6.U nP6.U nPs2Ԧ̚PYSeYZRjS {nU']̌*v^_ESc /Xj4(/|&9yciɨ_71[%ʡumղ\Y[%ʡuJeeiHj<@ܪrLJy_-'a~z&!wYRhZN [TEYXefqaM_"!~,w*#ܪO4"ÞkWutҿK-e|g,HlV\7SkU{;xU Q$'<,Z[rKB!ʔˆH5Ŕ~Z6YXv(P5iş~:&+2kɢz_1\ DLUQ ?-bv?co>b](x(҇dQQ~J{~Dت&y ~/UEd';'AY9TV`\/XU:#S 1Cdx](;2J6G҃M!tdx](;2J6G҃M!tHedhE Qq "V4XR(jJ~^J =gjݰ.<%!Acܬjor[:aT@P֦*dDÏ1 R(ݶMBiWj&*>޽V|$&}(FG-r&a'CZȫ]d>[ul*AVr]dul*AVr]dul*AVr]dul*AVr]dul*AVr]dul*AVr]dul*CvXzf |EL֪*j-t10Cˀvnh=Cj:|ϙ5+-`&>10ip];de౟o۫dT. KB!UhNɨxW+5 {]jF+SHEUEC4UJ=JGSK ܲi Nbn1r/IQ/IQ '$wao)jrb탼n"%BdV+Jzk: r\0d&Eo1Ǭv?ԆtH9{<LXˑYH툛\NeN5S~/zLw}7p}!Ctg#ZLQjoLfoԭnEF׫Sܻ{*>fk,Wf)) ʟ57mjj7^LUpUO뒩ƐB5pDZ NTB@.n1v6 X"Uq\OEUHk C $k_K6wh8QU: F97UQ\Ά3Wųwi-SVPOXzⳑOt~YڿŮTcrSsUPWEʚ%&j%_GUdj%_GUdj%_GUdj%_GUdjCUz`qמ+N,i#%U~aljqcUCeCL79=>%_GUdj%_GUdj%_GUdj%_GUdj%Y#W89ɟG'uG*.(a?.C5)#W*?h#Wz#G/}VV~7wu>NG?Udj-]?#Wҽ,z:赴L'OsWoơhi0)LErUUOb+݅ɋQɏIϺvz5݃UA]YeP9Cn(EBm5Z]'dVuqrwOo@}6,fMD6N[0qk^Vbp.K̄ȭ14WQ\u@aLcEu]XgTՆtH9{<LX0X랪ZxlsMHwc Y:K!DT`z'c*:•ئb\ )t c9ba&Sc2> =$XՑZ(F; = t %Md?i)kh eBFˎKg'׽DB=ڸ -Vv<yfV[!eJ #\7n0=zݢVKܘnz6 w֫]D2mq|H. & p/?7S  \M]\:OAhlk=- b'Av;) zf3!S*o kOĪNƘ9U}*uvnh=C[讳 12 +lCv+}/%O%BdV+Jzk: r\0d&Eo1Ǭv?ֆtH9{<LX{]?AC_`&"@$-瑹Q'-wERf/Iu^k,jd-#gyQ̇ M&2B spywqWQnYN%wNYoXR&h(~'1_MeX t]Dqe۬&cE5xi+ Iڞ,S喕~ SĆ m6)`N\,\~yа0tSQ2P4#@wg{}1WQ]ށ2mX1k}4a>sw E5c(3Epù&+3Ψ4\ ; [bh+#1ІtH;{<nN*Xv>ا;KKdH@caD]ҫ%auPm*\Uҫ%auPm*\Uҫ%auPm*\Uҫ%auPm*\U=h5rrzKCLȅ[ߵ.j`D# = /0nu dkSVV UvJ\~tj[&#EC"FȎKcX[>;J%ArX]TJ%C']HVNxMU!򮻉{EE HՋUUrXI$ķSB䩌8nyU< Ud,. VKUd,. VKUd,. VKUd,.$nk :Yw5v2NdB,̍dZJBKHCDNɂ0}/I55dx23<7wwU[ȫB9SdS]udAf2̘9UWʪ{]VKUd,.ʟśP60!Cc"ϖ-2ZY8jMB K]$mA)IH[ r"51]ײ[ȾVEg됚5*5ğziU䰺6Y.K Y,3X]T#}de촛26`Ol6u܊x t:buf+p֟܇, z,b3G!E?y>fk,R\-#^#1^"bjv˿Cv^br#T[.a>]D?Ȣ5p.VKUd,. VKUd,. VKUd,. VKUd,. VKUd,. VKUd,. VKꡊ/$)B|VB/BSh,ULLB8F_Mf0SQ o2΅X ҁ)^s; Y eR+D.Z?Jn~9\*c" %(anz*\Uҫ%auPm*\Uҫ%auPm*\Uҫ%auPm*\Uҫ%auPm*\UEM\%a!-G~ a#W@{ĸx]tŨGIHoV=0T8#/e3z)M]f3'9`qtSQr-# S(R20ψcDKsel/AdH{6Y.K iU䰺6Y.K iU䰺6Y.K iU䰺6Y.K iU䰺6Y.K iU䰺6Y.K iU䰺6Y.K iU䰺{RS)˧X !#;Zr>~:#Xh.w2"]ErWxFc;YцtHE{Nkm>1QRwhD}J8FQw=)<")<")<")<"GhTBd5Q70*W Σvmzqjy{]?AC_`&"@.ZuY٥DػTyAd,!퍲b+=wA6\|)<")~#n8qQWDnzrDWWst~8eOVZ2 d>*/@C>*/@C>*/@C>*/AwQzL_ٷa|SA~+[H|6JvLNy_MeY d>;*i;؟BfJ~R !EO!C>*/AVܣ˲*by {ǟZfpUWc.n1v86Yk38Qwdf[bn&z>*/@C"p?%때ˤ_ =˸CUUr⻪&?sYJﶜ75!;zDQ=NDcb1yx^T;0L5/Vi&,OB:_i.8Q\!7\ɞvPElGu1ent8mV51UDűr4V⛊|UJ͗ٽ*vɺF´cDu0<I95x)Kle!7鿄>a$(EH|T^EH|T^EH|T^EH|T^EH|T^EH|T^EH|T^5(qQy|YԯFrREz{5U?aLcEu]XgT҆tH;{;G1X t EtР&Q)Cj&ꯐཻ*yȎsUQSƛgQβ#]LS^k,jd-#gyQ.n1vW $m@dۧsk4v]ӆ<Ero~&4{>/Vi&,OB:_i.8{veU+dl.%FF"塖GѨpz⊨ޒUtw{\N;zYc4Lj!tWY@&bn$L0nyo&6+s Flr;>f$dE\7UNV9@aLcEu]XgTӆtH9{<LX{]?AC_`&"@2uXyki4LEs7$Ҭ*#eۼ]nF~>6#2=pLwg361龍D?I/MY`0DjkS}/I55dx23<먏@7IOw{\Eu,6uW}ṭ?.}e*$XZ(GK %G,UC}mf^AP[qyE~ ` -39|Gap@vnh=C[讳 M9]EvJKfBEdLM\0: ]{ttz(LLbq>sw E5c(=(69Dv(I,ґfd_ U\7ݾ%P;YՀfs!2+yMW%wf=cQԆtH9{<LX{]?AC_`&"@$-瑹Q'-wERf/IuYBĤ36ry?z+xzI#PwA]DzMѤYOs|/B.nYN%wN_MeX t]Dq')HMo:-2lށ2mX1k}4aIU3_6gtYc60CNhaϤݼ'- PA5[>wܤ[.K̄ȭ14WQ\u@aLcEu]XgTՆtH9{<LX9R3coig!SEN_zW|nUjύ_񺣽U>7TwgVQު;ZuGzW|nUjύ'%*6 cblS} /,MkQvID#Q,mjtI)XX\֮zW|nUjύ?Ti񺧟YZ/8t:jpS!n<Κ9k2.5xK|.n}p _Sy6jyUtOc*`𼶚%!Dŀy_MeY c:#151SS]r5N]_7TwgVSުX6NI][fQwu7qa0W&ǧp;Y*$GU>ӖrOLcKbzZJ\&?sYJﶜ75!0UrTE>6U>7TwgVQު;ZuGzW|nUjύ>Uj|oWO1bktT%+57ЉAt)(vKR\i6+Qwf*\Z$MYj>7TgVQު;ZuGzW|nUjύ_񺣽U>7TwgVQު;ZuGzW|nUjύ_oAV|oTrvFKg=7ƞ _UWYm#wsv+/U>7Twg8aj .yY49p_J`9Xe1b ,Z[_!91HbعSȧ"ngRVF5!ەޗOyڭn2{kuɓ6[LZrd'mV\=rWI ɶ5UҘ1^kE_Jz.EE0ʍAMeOCB!ߞ^Dr5"&ꪩ i3ZĔ)r$D".89U&Oxڭn2{kuɓ6[LZrd'mV|=}g@uYp"+Znz!i>sXz *mJuU_Є> H_BJW)(OCTZ-񺣽U>7TwgꅺV|n-1+<. )%BdV+Jzk: r\0d&Eo1Ǭv?ֆtH9{<LXʒY솛TBr6J_v֮(eba!*!!*! *! *! *! *! *! *! *! *!!v.^q 5p b5R| '#s=W'96N/宆; Uq}e⬏B⬏Bid pl>+W*)foGxt*>`SFMDEJM%|;;J}j ]"ՒvId9^EDH};>H};>H};>H};>H};>H};>H}~""q|zKy ?dmsC],juYر]0 Ipf[h+`n>x5r|ݒ"\J6NQ!Ōj*yCRVBV*sЇ[UCAUCAUCAUCAUCAUCAUCAUCAUCAUCAUCAUCAUCAUCAUCC#d, ?{VKPbDHkk}~U(KIW'Io6 =M^섅> l<M;⬏B⬏Br'Qqą1-[RSF]ơTLwj P-^ofٮÅ52\˺dKdEVUULKBK$쇖wGd<ú;!,?pyatvC71WY7q7g^. ɽH@صww7`s)> fEoZV+ v`j ZF.agܜ=br[Y+GdIB&嶎~X~쇖wGd<ú;!,?q(bEt4w} [.WV"=`5̼ukޫU]/cls`5U\ɐDԤ)ڤ4UTEOx clgn CFAB⬏B⬏B(.rB*;3)WqpB ӟ5W3Eɮs!1nEWQ\u@aLcEu]XgT׆tH9{<LX햨1K2^JV"&'I^LlᵐZ%wa[=Ѷqom{}286Oy\-;}mžn-hqoN-BXq&w710efNY윫٫uSj*yQ{L-}b19n-hqoOoo\oBJ[žF.$MOѺx!n<Κ9k2.5xKeF}]P3>E[e-}ջڴ1mB#QwʤhS )?"W"ާ}i萠3f!~5YF!}/I55dx23<먏@`úJsbuDU2#v r 7O~Bcq2?n-hqoFۋ}ǷtՌj ‰2L710=J3VWH̜c6N`[5Pקhf'r5$D\1Sdۧsk4v_Veҵn8vnUD/i[=Ѷqom{}mžn-hqoFۋ}Ƿ6[=Ӥe5miخ= f*V,gb:).q4x Eu$5^${ĕ߄JȺRFWvs#Xv+,f&+mžn-hqoFۋ}Ƿ6[=Ѷqom{}mžn-iLm3}mͻ~W+{Ƿ6[=Ѷqo֋(gi,)د10i qvZ !^&7+kz#~[=Ѷqi'CXɆڥSLfe\\8 S-MZDԲm4*qoalӍN78߫;[?~`lӍN768߫rˮ?(Dv{FRܑ[IQ:磕x5U]. ݋vUYj/W*^\a>9|?8߫;[?~`lӍN78߫;[?~`lӍ%q9Ӱ*BxWw* uRlQQĺkWm*,Q6 D!M@u!lr0LE?n-hqoOooW][ϯ^4fĩF#wQ91[muUp_\et80Z`r r\0d&Eo1Ǭv?ІtH9{<LXk\wO T/=q,(MH[#sNZ r~^&>6uW}ṭ?.jW =$XՑZ(F; =ҽ\? 8B/%]_.+:jq2m95;D j<9RrQR+$=Q_ ?'H̷ѴWQ^]= NW MapR?'N>{[Bޟojn\Ч<2v>Hk*PVnvS @k? fs!2+yMW%wf=cQцtH9{<LX}ڏƮzKr'NRڪ=_r 50# p,WNFʄd\|+k4YɷOì'\h iyp+xzI#PwA]Dz#"VZ~΢Z@ t:buf+p֟܇>Z]TB}9Kt9hmUDUTn/aƀL>r#8Fe~-SB1 "3vBxCJa vgK򿗇< EuG8B/%e+9.ɷOì'\h iyp/Vi&,OB:_i.8 Ipf[h+`z =fWٝ/4\ ; [bh+#1^x(7rJI]c4/~ͲDzaWQK15"o9^8ӆtH;{<Lm!#1Sd"*5nꪩ,[iXqj0]NnқiQz:j![ D%ED)Ya*L+xzI#PwA]Dz.5Yخrn2dm$ūzȢڧFқiQz:m)JmFқiQz:m)JmN\D6f3XnKQ$5X+1]%e_tP7NQ&?sYJﶼ75!Ƴ6bkd!,HDOJ,Ȫڹ7u<~OGB6УiMt(Sm= 6OGB6УiMt)Ȧ$fo}$/*T7GDTF/ܡ_'Q G61j*J[)ES*bT\Q='Sm= 6OGB6УiMt(Sm= 6OGB6УiMt(Sm= 6OGB6УiMt(Sm= 6OGB;ɸ%=mX ٔ_U3]7kSnYN%wN{XRz Q~R~1Ÿc` jan LY< E%%~N&ohv;h/ZeЗ`T\9ʦsSm= 6OGB6УiMt(Sm= 6OGB6Ч[F; xCW>9Ȋ`ʽQTw_I5]}ǎXj|HfF ",=/vOGB6УiMt(Sm= 6OGB6УiMt(Sm= 6OGB6УiMt(Sm= 6OGB6УiMt(Sm= 6OGB6УiMt(Sm= 6OGB6Ц[>O":nީdda/Uwf=cՈkN5<'[JmFқiQz:m)JmFқiQz:m)JmFқiQz:m)JmFқiQz:m)JmFқiQz:m)JmIYv9*ڻ9Ak.Ȥz.1Bą0T q'QzRs~w7{JmFқiQz:m)JmFқiQz:m)JmFқiQz:m)?LȞ9pS+iksi7.Brd\VJ\^V/IQ`ԆtHC{p%}Z4K }%BsbTOB %zVB1 q7ײ>|.쏟 E{e(1kUwТKϼQ_[%|"^k,jd-#gyQSv95Z_ieV&ZC ǽk!_ }{#A^Pwײ>|.쏟 }{#A^Pwײ>|.쏟 dY h|-Je# EF& C^񽙫ׯD{˱O/€&?sYJR7h# ,Y ʊz%"|]({>JGυ҃td|](;>JGυ҃teYg q|p3( 79nעl[^|X8lvKDɲP+Pjף0Vʘ"K³cPHL0󾽑td|](;>JGυ҃td|](;>JGυ҃td|](;>JGυ҃td|](wk4espT^c͟!H1TTUE)va WOJ:|⚟g&>_VQչO?Cr ,8i_fDYg)r0gXz.d&Y[gi b"`klm|KS9.r'/Vi&¬l(tX>24x*.; Ipf[h+6N®2gYD^r7G BjSē쏟 }{#A^Pwײ>|.쏟 }{#A^PŽk"TC[_gjМx <ڿd֢FҡFrTVy@ u=ѳU+pΗxLyD/_"[4HS3z/;qk,u"M*o^Pwײ>|.쏟 }{#A^Pwײ>|.쏟 }{#A^Pwײ>|.쏟 }{#A^Pwײ>|.쏟 }{#A^Pwײ>|.쏟 }{#A^Pwײ>|.;5YLEBen"RH͚('–jWlQUUR2JX%,Dbws?>JGυ҃td|](;>JGυ҃td|](;>JGυ҃td|](;>JGυ҃td|](;>JGυ҃td|](;>J벂c0]PoBlI]/]uH):!#dp<_Uڛc|)2}{#A^Pwײ>|.쏟 }{#A^Pwײ>|.쏟 }{#A^Pwײ>|.쏟 ;ٲ-\vpPrnXJ(!O'JEDF.*R5 qS=:sޫcՆtH?{ʭ;'cjJI01.T;+ܺ?whҽˣGv+ܺ?wiÝuZ?\*tbt+xzI#PwA]Dz_-RzPvATv)1Z+=;wi^Gv];wi^Gv];wi^Gv];wi^Gv];-0YݧO7R\c|M7+&?sYJµp]e%VQ05+_v];wi^Gv];wi^Gv];wi^Gv];wi^Gv];Zjan3v39늪Tէd##4\vl;wi^Gv];'thaF[m__u?=Wthݥ{GWthݥ{GWthݥ{GWthݥ{GWthκgGvTRryz{|U:&q#'xy؊7Ĉxџ0{ܮsU>`LjޱXո7A/k+ 70j*Uw1č@.ȾE24—d wpDOPU芛؝p8Fe~5Pܭ_Bw0mj`Ȟi^Gv];wi^Gv];wi^Gv];wi^Ovvr7idlGar⇡^\ݡV\""of";}ʼ|@2{FWD{}ó:_q9RQ~a\gei0[˰G~Ȏآt`y+ܺ?wiҽˣGv+ܺ?whҽˣGv+ܺ?whҽˣGv+ܺ?whҽˣGv+ܺ?whҽˣGv+ܺ?whҽˣGv+ܺ?whҽˣGv+ܺ?whҽˣGv+ܺ?whҽˣGv+ܺ?whҽˣGv+ܺ?whҽˣGvŶu& =;ꦪhSȏUЧu/i9OCr{rݣJ.;rݣJ.;rݣJ.;rݣJ.;rݣJ.;rݣJ.;rݣJ.;rݣJ.;rݣJ.;rݣJ.;rݧ-L;SݧGf,rUTJ09*-r`螱ݧJ.;rݣJ.;rݣJ.;rݣJ.;rݣJ.;rݣJ.;rݣJ.pf- RoQ: ֆtH;{<`WYcVG!h<κɷOì'\h iypdj։ȒsW= N[#NHRj*t%5:jb_9fq7'YoXR&h(~'1%%~N&oh>a:*;6j%{׆tH9{<LX}/I55dx23<먏@ t:buf+p֟܇;nas!I̐wA+-?E]EqQtݭN YX+2fB~X%bEjcy1%WQ]BC*97P S"|+> oU:COh٪ovgK*"UWTuM"bU, z,b3G!E?yDIȉ*dqs3nk-Q"G9=*T3eBH_"JJn2y"; u=ѳU+pΗxцtH9{<LXkUʈ+w#ƈMQ~S|~sGOHv>߃MX'9<~JGm6$r[SjYC;NNċQ־,'uV/1:gn"z_<~sGOHv?9#'?x;dl<~sGOHv?9#'?x;dl<~sO?${98Պ9=*X-d_[7h=b1{6{L^ʌQc}WtHP֦*C3{vIglWƨLCGFz\zhꍠv;tlm2pj6#1Db1X)AWiHCY?5h/rXi70j*b`njDUHz|G "̽~>_ qV&t7OLsS*n68ɉn'R.F4+@ݛalU|eŪ''?x;dl<~sGOIP ];ۼXjk[)j!D'EOylm۪*|5{ިO*g?b{Ƨk<~sGOHv?9#'?IL\$_fpBlUnٻ9p ks2 Iygc7'D(S6i.A5UOI{Zs&9") g;G!.-aEJgc)w_I5]}ǎbH[z d_!*NA36Z\1 MβN҆tH9{<LX c,TG|&;bC+^Z*090I{I g|Y|R􈒒raSu>er]dyRb|4gk UpplMoơn&Ik!mYedW*JvOCr$ߚ҇o5p~ۗ}}d<{YT$d{n+rд׮ئ*z{9\UU\UW~@'9[IEkWf,s^lFC&e;2F&zɿ[w"c\UqS q(d%Š"h\UL?%8 z =fWٝ/dMgOy T(VZrbs*:&y(twnP5n;_|yʫӆtH9{<LXʒYH툛\Nkj%ލM棕yUr⻪(. ݓڞUB2[29Zqrʾ)LI:|eb)SժU39]Ԋu)q:?)q:)q:>ЗLj;9z&3}N AWiHC12x|vJd31 w  K|+#.Lzr- 3U|~s2f4T*{? u=ѳU+pΗxށ2hYmLCF9S榢_i#pj󡃀ԆtH9{<LX&j{ W.N.;5\/Vi&l,HTHPBG|h6K]Dk1EU]CHXڜFํ_|2ay;nas!I̐\b%=pm@W*"o,՘əl5صqU_:۳lK1+͢i)G#hs2f4T*{? u=ѳU+pΗxށ2mX1k}4a?ՆtH9{<LX7IOw{\Eu,_MeX t]DqHa1 MdۢQ~5) x7 s*`N۠X\y+o$!7IOw{\Eu,4Yb'h/4Q@+͢i)G#hs2f4T*{? v.FנO YeOJ938pu3Da覢o 7EudֆtH9{<LX}[+c=ⱼt(o1 >+wBУⱼt(o1 >+wBУⱼt(o1 >+wBУⱼt(o1 Z*}Gt)Vw%.S]D Wo&'%wBߊУⱼt(o1 >+wBУⱼt(o1 >+wBЧ"VJa ꯔHe&lS}ACt9(vKy_MeY(HZ(F[j6r#AWiHCoULOcyQXc /.ŎKS^*Pc殢\>;GţySon*~EShЧⱼt(o1 >+wBwB5EC4Yb'h/4Q@ݼ}>-wBУⱼt(o1 JۀhI|JdEJ$l|WwB\Z &Tc2S,$`1;Cxeৎ>͗Ne?;Nށ++FŪ57C;讳 ׆tH;{< qu ٬cڬk^WzRh$Y)i/ 汩Cڟd<. Kڟd<. Kڟd<. Kڟd<. Kڟd<. Kڟd<. Kڟd<. KղSP9R^ynY'!l@9cb*1qLN8rx]TS'C,웬6!Bj̲썐-EM U# r"'rS'A>rx]TS'C̘,:E$ą@_UYTUEB9_MeX t]Dq.j*UBn)TF;b6IvFC>rx]TS'A>rx]T2ɲS$b5UUw &HXh\T* g;G!.-aEJgc)(#3j[aEm"fu"!:o> ٱjWseyw l)Q!bDCڟd<.fJJ'-"!obl݃W{_-{a*7dІtHE{OFZULpOwakݨ<;IPcQ>+s?^%%?m!u;O߄&y_POhSCoi/ -_m`:u Va^*p>򿗇< EuG;nas!J2o e ^\w0&]'/TX'[GiX-X-3D+/[D=^dwEW|}el٪.>"l٬',`V&n+{OKX- ;~V/Kh@+x1T[G"7pcg"5ULWb9^H0[ Q\+dL]XF"y WXɧJ*{w0f?hӇX-X-X-[ꖖZFʘ'B.SLfa\UW_MeX t]Dq%Υ݌g&U)e$X`ç{E%PrJouGouGouGo߄FJr[D;ҾGtIw*4g;G!.-aEJgc)1"ơ>j*"a\pĐa1nQY\ @IXTy,^OQj⒱z[GYsm呑&r~X\tx|gNцtH;{<`//j"CsyTMES.n1v6 X.#Ses$dcTb8MW*}e*$XZ(GK %G|WHX25v E:p7̄M+dp""NlTLN҆tH9{<LXc+k^*6,p$(jT\HzPL`%.S]D 6~ Z3.wəLz-U&#+SH2}/I55dx23<먏@vC_!.%1舸l[t+[!f1[`C! U'cs(-|W-2.Rf/I84Yb'h/4Q@n)q\`E7<37[1!CEl\:@30qU3̔tNC=Ȋ&z.#|EOse+Wc&uӆtH9{<LX,? K+7D1tSZj:02m95;DisZr\sUl`s|{[Cbw?g-:g_'OR)1*|B Ч5ɂw82J8-4~?jpDZ7e/+E83St:%L%9"|=CekGzOl}E"yLyQyS:\IV֗1$F Sz6&e4JM%|6N3Pr6 7=WȘV\Q"/w?g-:yc|N/sYI~JgM"6Pf \.uTKU&e$>yc|Nm|$d"t^c4V#0O89JhJe+H+7̄M+dK̲^Vzjbd.ű>'@1l~ωu[j)WEOA&c;cPށ2mX1k}4a?ՆtH9{<LX,? K+7D1tSZƛJFHPrN+Ȋ",xnd5wP:, 7 ˏBYHBȢJBͮVKЃkt d]6Y.*B VKЃkt!lY*}:$4l& JLKDb⊟5J&s fTDnKO$E*UO+Q\L|Dd]uU,at!-L6fegD e |;B٪$UdF2m95;DisZr\'f}eD.# ՘*(UD\X3 FCM"!Y$?pry!+=df16 ܙ썜hCb!⪨BfT%,ֹ`B"$XLO3uZY' TZKҁ].cf`J8Q߱LpULK-tXp!60b&5d|}(z Y *=x/ JbXrUE_Lzr|kAYb}eD.{"왨0*-jफ़WnY-b2nyg,w9d<ù!?LAEvB=5fy t2kʒ6 j N.v VP%O컜H~=f쓡 EӰnf,bջlW[]"ܳb+Wq@%vOM%2$mWwB\Z &1!~ 4Έr28?Dc*U$w*D,!Y$?pry!}2VNIh(-52RLMopu3Da覢o 7EudֆtH9{<LX,? K+7D1tSZvtZ L\D.#, Tn9[RY; Bo|УDLSn!#W,gᏍQ>Ȯ_?-'wXm\arwuE-'wXm\c5ͧ XNn?VfxqiWyWYKT/0fQq%-B."aZ.N^җvHwܷPTl7+7Mr^**c$36Rz;ύTC c|AnYN%wN2KAz5Ȥhn]"& xo|8($;CVޫhmVޫhmVޫhVޫh+9D[j%16\S0B=F"ĊU|gg:䭙Æa!U-dkqs] Ut}-7#*՞*bGhgUF4b\tVsXES}J;e bZ 0OFD=O|KM~u?/Hj4s)S_r; TT9 뼎E'U&~eدs*y;o-|8$;CmVޫhmVޫhmVޫhVޫhE[z%m"aJ*Ō퓔vrkVUQd#U9݊lTt1rLJjg2!kR vɷOì'\h iyp.|V5wȞM+M1o5Ʋr "a7IOw{\Eu,tF*`tjd%UQjXGn9}!5;:5WEUSޥHZ} B%vOM%2$mWwB\Z &Tc2Svnh=C[讳 цtH9{<LX,? K+7D1tSZOt7yLbG`d'$< n$&]B"YPX\>^v0iy t:buf+p֟܇>򿗇< EuGK]UIKpPxK YʳI5%bKuDIuJhJe+H+7̄M+d#/e3z)M]f҆tH9{<LX,? K+7D1tSZN۠X\y+o$!OtP7IȐ921R&+ U,X*xkmrIV*dۧsk4v]ӆ<M~g1:Ghm8nkOCˀ c.Ʒn#$9(.v>< X2Q%>1&t e7Sp=$XՑZ(F; ?b#ajTDDUU&[k-5* *cz}'j8CGhuTmwꍡ֣Q:qߪ6Z;FQ~$#KGg{c0PVJfRcÏT+x?բ|YV8,MǪ}%z=&vj8CGhuTmwꍡ֣Q:qߪ6Z;FQ~j8CGhuTmw>'DD6QLc]ɂQQWLL5XU&%=sU/Vi&,OB:_i.8}e*$XZ(GK %G+͢i)G#hs2f4T*{?"Z3hmDl*/$B,4|GlqlNFQ~j8CGkDFß卼dZ tUW"7AVWeDTHӆtH9{<LX,? K+7D1tSZN۠X\y+o$!OtP7IȐ&INWiX&=l}l6!#YjVڸ̻X| #LԳb+]84Y`: .ȟ5 Z<}e*$XZ(GK %G+͢i)G#hs2f4T*{?Kd)U@rf,BX͆6(l} cQS҆0dx](;6JvG҇(Q/+ / 5Ux-#mEr$wW 9jԆtH9{<LX,? K+7D1tSZN۠X\y+o$!OtP7IȐ&nM8WD%3ޕq~3!=]T#=^UsUUwUU|g&?sYJﶜ75!;;TZDFONU[o\rYBӬݼ1^%+(+aSlwLQ0WYcVG!h=κ vbЈ9SQnbGv<7whnc{Gv<7whnc{Gv<7whnc{Gv<7whnc{GvVjLb*ypGq{$%ŮT\skLb*s=ݧ序)>[ݣ序)~[cL뻴:R]řwinc{Gv<7whnc{Gv<7whnc{Gv<7whnc{Gvߖ<7wihjO#OINOKr,)軞'.(eQ5!OoJdYw911$Iqb\SO["+1T-zTx<|ZySX@Jcn\i&Zֵ]E:*<t>-zTx<|ZśHPQҤ[,Y&SWh %<v̓?]% ‰!S^s]7kRTdۓ=J'ado. ?Ϳ>t>-zTx<|ZyS܇i6rUXW-lOb\+-Vdß皻Tj:|5rSdLQ_ _ZKsՈUUWv:*<t>-zTx<|ZyQkңCץG·ůJ ;zHFw6,텠*bCgĆNWevew%vOM%2$mW&$ɫ#΂7l\Sa-|t>-zTx<|Z. %"n#ъ(+eIF\0LjXJIo_%E#1̓ESgX?·ůJ^:*c{w&J+[cW=sObSvnh=C[讳 цtH9{<LXtTWGi#.ŊxԆRVD"bȯ M&2B t Et\b%=pm@`#+=\~Xro&X5DL7Q1,2feF'-[< 6[0ޓ~لߘCܥ#eKzGrv~5"&L"y~~[7l܎ELwQ=qYu IF\^US=$XՑZ(F; = )֯CJ݊*.8V[3(nl+L~;*2ޓܥ#eKzGr(}he6&QtU!4vqw*եs"n=-3ދ(vwQ"}SѦeR}"'Wb4- 2! ±D3DŽr --[`bh(υN𑝸j$*ʯZL>Ә*5Ȼ- +ddY#15-[< 6[7#̷re ^'A*nUg, ݖ+9g7/UP>V"! 6[x@l)oHnRޓV[t$*|_FBkU&b+q?AӀvnh=C[讳 ҆tH9{<LXȕ[7OjE|G*= t %Md?7YRI)2 vTUخXPbGvōW/3)OOOO꩕P]f^"yNz*nZQ 4+~ޟ܇~ E^d>%0S)U>3?}U-dⲙ d'MR.a;uC1c*OOL'|] MTC%.S]D ?p*U_"&'3#3?37Tg' S? 3)⻨qrZ-3\*PUCS U?Q)USH߆jEM8F_Mf0SQ o2ֆtH;{<?rc-[$\$by {| c!JAM%TW|%]IR@0n&*dx]6"BLvI\ RYk$F|1σW|K]$mAe.f0WʈT)MYʲ2$xqИma~<:STĺ{Q|vZ_ ᵍOWL)1>. sxS߄B2Vҭ:5k? Z'i-f]V>]#+V=YʪVo-G‚T`I|щ,ҝ Z'hV3|c f+VY'i owT|EUرN17IO{{ EHsdmJYyH{%EęVw.Zl(r NxA\dj&Y;G'i)l`;u}cH0+U<O|B]DT.&[#uTX BoF{!IpX5QuG(ع/tKE??ҘTMc%>R]n+ZV_:f*%0W1Qw1Lx?N ޛa9an*Nv;&ZzGFۚ{#;(1ZuzC⧖7eZ(1nzMvbvVz"5"A u*Je+1E\wY`[闫?iqoFۋ}Ƿu5l^É2nc`z^n0^z@6(p_vEW]O4S M.*',=V\SkJ:Üh*nixA\dj&Y;GɟN^nY{Kt(k _UOB! DtW+o@}6,fMD5n0ІtH;{<`'$< n$w4,Uʬj[:9SȪLb5=);oX-|0.US0K,Wl|D.n1vw(WQYi.X.!l"8K9Xenԙ)<UUFbF9*"K`ÁS|˾=ĐZīOǙ#NՀB)IVrbU/jfh.}6enmzL|jGpu3Da覢o 7EudцtH9{<LX{]?AC_`&"@2X [8+Yj?Uk!LR6Z5,%|Y*%BB:_i.87IOw{\Eu,YoXRb9$~_C71cUDOH)qn‡310j*yܳlB'U<8^]F$J,dU@gډ^EZHq~-DU.wp:pu3Da覢o 7Eud҆tH9{<LX{]?AC_`&"@$-瑹Q'-wERf/Iu/Vi&,OB:_i.87IOy{\Eu(YoXR&h(~'14Yb'h/4Q@3-4mW3ŻcTzֆ;EJܪd#/e3z)M]fӆtH9{<LX;je ~d'=WȆJ{m<|:{_.nFכu6ۮ@rt6;my\#kͺ^m wHnFכuMWDBt̢G̢dIYen9uɾ$4\6[ȫ?[i;5+U%0&'ɻBy5rpd]+k4YHp֦*C,vS⒮T__"s1m)JmOE6YľRhdh"(LpE+('N„r# ILO_!i)ljGzpۮ@rt6;my\#kͺ^m wHnFכu6ۮ@)}I&>r Ө ;`c,,غ4hq7bV(HP֦*d k- ),0(\OқiQz:Ev͕9u])0+^MYFUX5b.ΝG/ U!]]z7CMǑz+USY< E%%~N&ohKƚr6UʾD=&-]myEzD/Oכu6ۮ@5\[iJGđr""xmlJ#&a+`3̔fUǣ%`:" -pviS߂wNכu6ۮ@rt 'tڄY}4񓥷mh(2,Բ~ߌ7BF ԆtH9{<LXͧJ8I^E8YHSu\Xv61ѰscC~pP߸~(~o??7C~qꖲQ +1pujH,GS5C5h0l le_{d0!mETMVYU/A*AVj."x7NH|S`h.k> 験"\_πd 6MN9~EEC`[t6>,6Z^MknzP쏟 }{#Cز-r.%chQ!c F*&y y/ akw=& 1TBղ)*] n.twb9"y p~(~o??7C~pP߸)|Dr1]Hz|$4صw1C^̭ @\a#M&+>rHɾ-TǙg$TU mY  v-UDusзʇd|](;>JKݲ2-} YJY'PbÆ`kyVeEUQ:Oȕ >gVN4JSUQD%T~]՟tDl65|I5ⷶN?fp_)4Yb6*#[KT#r#8Fe~8xHTM2MvR- ~ 7QKc,\C8mا {7z|~(~o??7=5LG=V"e[)J#d\7"`QO+ܽ*q@;?MZ)tD6&5 jyswQ jl9!"CL9pP߸~(~ord{:k""jC\( UD1ՆtH9{<LXfRN~ UkII6a`^r0W1mśl45Ort 뗻m\l5a/w@ n{ku6[^rt 뗻_Yyʊc*Vj|w|gF:ұv C]9=2I{MvI;fON)(Q-ay.>#[r3X\G F EnNBy5rpd]+k4Yi>3;Oy|y7yDLz XJm.2]*\OEXܪ5MG]ݥ{GWthݥ{G8sV:E,Gv(\Bb짧B=71?Iƶm^5kX&ӊj1jn=l5a/w@ n{ku6ۮ^rt 뗻m\Aۧ(99VĮ=8Id.U`Kcr'w') +аDkg}WE*:ˊ*!USij$ZuU\~ݥ{GWthݥ{G:FGSTwfڎK"./^na6SQ 2kEoY!1~1Ujx !x.E*-Lҥ!r"~+W?iL|@R\i6+KNو97}ӮΫبOB}t+_T 9Qq_Qr]ϯG=뗻m\Aۧ >-nѮ3y?JB.$ǑzYiTja1=-\ӣŜFc"tv[^rt 뗻m\AWW]bfqE ֆtH9{<LXE;zEv!WyW SZ05 '>z,XUD]NFMDEJM%|;5²ޱ -Ub5W WQ\aUUw9D51=jG=ʛM7=KsJ90gRbM7V2, z,b3G!M?y@UW|).q4x Eu%M]mtj f/Vj;? 9!U&صu|~*ίbGr?xYX+2fB~R\i6+JhJe+H+.JZ zk0u صTc2Sv66$Q^btXaa>jo"'ژV[2ІtH9{<LX}/I55dx23<먏@+Od􂣓=QKQ#*']D)験"\_πyfV[!cɚ?q /?DvC_!.pE_订n֧, z,b3G!E?y*{tXQ0Of{̖|*,eT+͢i)G#hs2f4T*{?pu3Da覢o 7EudцtH;{<J$'' bED־rR >:r7q19@(wTm\S?h(V"U1$Svt8۸ +xzI#PwA]Dz٩K02W9W %=+#_PIX1i-lLWC0?7IOw{\Eu,H[#sNZ r~^&>ݛ\*,2? lET?q "DoczE"n7VVĉpDO' ![ETc9G*#w;Mv;6.PhChꍠv;6.PhCh B6Fc)mT|LÉɕ;̞fM+1,m_dRvq3 b.[՟Kʱ q7cl %A6qPm\l.cl %A6qPm\l.<ͪ"Đ jy E+uFl7Qʛ//7irvC_!JSuE`&V.YV v x\&P6.6J K҃lmat2t},.++)6 l7QSTw$G;ʪ*|.yhqc9qCbaQ8l51Ua[a t6Ņov.6J K҇_)+%#^an.;cPt'=Z`Pm)'GUaLM7h]b[1#e.T nDzP f&pH`h|Ywoőp6YW k|/4\yUfQW3|*9V_R49yX%)o*/b"30CŸDdW`ՈWuMH-r&**URf퍲\l.cl %B>R6jN4pTDLU|R=vv$xkO' e۬&cE5xi+ ӆtH={uy7шrNswhNswhNswi7a0OWYy_MeY c:#[GQ!|SxHʵJ.SLw$%.S]D Z{ꛇvjU$rt!ZmBi^^p4MߦtW/\P'mp,.dSu>Su6:> ,u\UTp?\„YȅM/U0ZP)KV:&(TD塩Xbʸq>Su>Su>Su|91DrT3'yU Ɏ #(zbHGs>v;U,x&^suUWSz5D{ r,bz{"p:7̄M+Iʋv}Ng/iNswhNswhNswi3c{π#/e3z)M]fԆtH;{<LV}/I55dx23<먏@{]?AC_`&"@7IOw{\Eu,I 9pDMS3YO!=b2iLT#PAWiHCw4[=P1 N ;džsƑsTW΢lѻB>7a"ypsw7h%Z$R⨖CX}U_~%vW.(?JD 19pDMS2YԜسp=SY1WϒB{&S :WE: q!t]WuMdۧsk4v]ӆ<yfV[!cɚ?q /?D4Yb'h/4Q@&RR,D 1U>7wDt76ỂSc?v#*# !LfzII7Їj}6.O j}6.O j}6.O .O$#^ [g RBn;!GvBa풫Wb/Wz[3eLeXs ,Z˲byk\`IS؉+?+O?@cI"M"r2_YZG1oQ=Cl Fm0pІtH9{<LXlR+2t%u0"ÇSUD;">^c& a5"4/=Wv wU{B绪? 黪_J fVZ#sU7U-EQWdg آݼF=Cd6=ۉ滰D(^{~E(p{<=$OȾ^E"**o*k+wnɵUUD1aef>xSd`狩UU,}M+jlZ&|/Bnۉ滰xD(^{<"/=U:+C%{U#]U^5F*q&=UسLv'mp,.d`Dİ떳S4(NF(SQLdhBH[p:2*}UVsMdۧsk4v]ӆ<sg\˪֡Cb*R ^TYG'y8_aEpJ#/e3z)M]f#/e3z)M]fԆtH9{<LX?l苃QWãOL["5O.M &QKE(ɢ|Rz>@rhE T4^*\/QG.M &QKE(ɢ|Rz>@rhE?M7. -Iw)j-8$"bR.O&X 3 &Y)+-E-$ArlF[@}ŋX̊$h_INtS# Q#EʄER#~Qzk'c*o+ɺCF+kpgwgwgwgwgwgwgwgwgwgwgwgK r5$HnK7a1.jdN8oDŌU!J9e HTTkWAdU9A/4^ߐ*\/QG.M &R^db1Ŋxڤz(WXwUzTdۧsk4v]ӆ<&N/GcE3Lt;Ć=&礧JN[Asۏ+Rz~>@rhE T4^*\/QG.M &QKE(ɢ9HDO3,s)+abrdf'R 7=Sbtߐ*\/QG.M E)Í!3/9q7BpcUɉm %/ ~@rhE T4^*\/QNށ@|/R)4ɸ0pߛEO /+MEWY;zYc4Lj!tWY@ՆtH9{<LX阭.䏑콺d9p_Y|JBAk>%t! dx];Y*BGЃ%t dx];Y*BGЃ%t dx];Y*BGЃ%t dx]rnȣp.X" 7)̩,Ղƅ-`kmyn+*]/1z=muV4d\C4gY5; zW+w~!5![n`UMIp.6,W==^?$NXHo~uKrɞY;/+ SaTLUU1ULqN8oCߓ|d|#'Y$?p:!G>N>H~uC|d|#;*|U?qzv.Kv)BR,*"9Ej#t+Kh-UB,ӶO:n~^bW")~=휥ǚ=Zs'#-Xnz2unYGЃ%t!pIt!vND\!QȅKW_*,NY =TJLUʈ^MyQp'r.BJpBz{Y*BGЃ%t!ΦM5  qȻv`l6 Ʈa5ƿy*ATV0o@}6,fMD5n0ֆtH9{<LXȌRo#T۾rtrPڊkS1S#ZYd'MXoSoSoSoSoSoSoSoSoSoSoSoSoSoSoM)Z jzBEL1G*[*ů/\pUOy$Lυ-^XO\tV&;as~RGraUF3N@؎j*'Uj⛊zUQ0V"xY2I'k{}6[[^ѶZrmܽle-/h-oyo{Fk{}6[[^ѶZr)[|s"2{V"jZ$v 1HsUW}UqSIgTMNo MtXb"tjMsoSoSoS]͎)^(kUKu껸'6uW}ṭ?.ÈNG5U7 cXOD.)q(hՂv[|m_|m_|m_|m_|m_|m_|m_8<|آM{lmBL:4⪸}m 4rq\>QS2) oSoSxZ&#u_5n,5Uq_*_5uTѭVŒXw0uD6W O$-瑹Q'-wERf/Iu6uW}ṭ?.-ՐvZ6+-|FGDnc)Y5jc3sa?ҢʥF; âğF&꧌SuGa7|d?µCz+bazXVWc>qߪ6Z;FQ~j8CGhuTmwꍡ֣Q:qߪ6Z;FQ~j8CGhuTmwꍡ֣Q:qߪ6Z;FQ~j8CGhuTmwꍡ֣Q:qߪfȖQF}_A1EG5hK7OsۨVAoӈshuTmwꍡ֣Q:qߪ6Z;FQ~j8CGhuTmwꍡ֣Q:qߪ6Z;FQ~j8CGhuTmwꍡ֣Q:qߪ6Z;FQ~j8CGhuTmwꍡ֣Q:qߪ6Z;FQ~j8CGhuTmwꍡ֣Q:qߪ6Z;FQ~j82d3i ۈio&UUQ0M~eʤ*}>#1\7U=c! P梬]OQ~j8CGhuTmwꍡ֣Q:qߪ6Z;FQ~j8CGhuTmwꍡ֣Q:qߪ6Z;FQ~j8CGhuTmwꍡ֣Q:qߪ6Z;FQ~j8CGhuTmwꍡ֣Q:qߪ6Z;FQ~j8CGhuTwꞚEPŌcih7d=K)728o+]4&=5ѭ"VMDQ^:?ӠU]z[9h#&㺅\Х#ra.bvB,PȉvKCPw[ݣ序)>[ݣ序)>[ݣ序)>[ݣ序)>[ݣ序)>[ݣ序)>[ݣ序)>[ݣ序)>[ݣ序)>[ݣ序)>[ݣ序)>[ݣ序)P]ݧ,hMw:&\Z9yif"3ܟync{Gv<7whnc{Gv<7whnc{Gv<7whnc{Gv<7whnc{Gv<7whnc{Gv<7whnc{Gv<7whnc{Gv<7whnc{Gv<7whnc{Gv<7whnc{Gv<7whnc{Gv<7whnc{Gv<7whnc{Gv<7whnc{Gv<7whnc{Gv<7whnc{Gv<7whnc{Gv<7whnc{Gv<7whnc{Gv<7wiƋ=1{ܫ#S9Gg>G-yLohG-yLohG-yLohG-yLohG-yLohG-yLohG-yLohG-yLohG-yLohG-yLohG-yLohG-yLohG-yLohG-yLohG-yLohG-yLohG-yLohG-yLohG-yLohT*z^; endstream endobj 105 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/5513630024U0BS#=K# _LR@R!9K3@%+ -# endstream endobj 106 0 obj <> endobj 107 0 obj <> endobj 108 0 obj [1.0 1.0 1.0 1.0] endobj 109 0 obj <> endobj 110 0 obj <> endobj 111 0 obj <>stream AdobedC    u   _ 5s!1U36AQRSTaqr"274Bbdt#CD% $&E'()*89:FGHIJVWXYZcefghijuvwxyz?Я ަYa EJ>3nn;ShZhπ킩Sݾ6?7(m0nP'l`ܡNChr;gR{mAtW',{l;Nooe.5EWumȪ-wbٯQZz|>ܠNr;g v D6?7(m0nP'l`ܡNChr;g v D6?7(m0nP'la}sGM{.:OPo]{n7Ymr#Y -w[5DŽת/r;g v D6?7(m0nP'l`ܡNChr;g v D6?7(m0nP'laNb8N>Ka;Y斲h:;)qZmEW*ݼ}-^3k\6&v6?7(m0nP'l`ܡNChr;g v D6?7(m0nP'l`ܡNChr;g v D6?7(m0nP'l`ܡNXTtw;bԿbN:Z;sV&;m>i$XW-r^wehc&R}MD6?|We#sRtjn @r욷o-Qsmjo%~j,KBҭb=> v D6?7(m0nP'l`ܡNChr;g v D6?7(m0nP'l`ܡNCh eK> ұ%棖og+ FbuںԘvtjүOn)(54W",DUNޢD—EGFj}VZ+!frz3U5ҳ[LG')N\Ԝ߳_v9c9c9c9c9c9c9c9c9c9c9c9c9c9g"*G~8!gb=.U?`/|3)"F)ߌgN=9=9=9=9=9=9=9=9=9=9=9=9=9=9qFMHrv]'w/Q-qMDžTY8+i1ItW/㻳8}9=9=9=9=9=9=9=9=9=9=9=9=9=9=9=9=9=9=9=9zcDܮ^˕U}'?8pnUO:ьZI.+N"9c9gi7tGplWIK~-*N6|odb7T 9c9c9c9c9c9c9c9c9c9c9c9c9c9c9gyl%ih 'EعS$_]$i)Įs7F¿ό~wxkwxkwxkwxkwxkwxkwxkwxk=hL;eʪZsd \|Q1OC~+wxkwxkwxkwxkwxkwxk JN'9}*StUJ]%"+n}M]+Sd9. %4e w#8QCӯY: ͻz>qW~XNz+׮D$>n$~?q{jqG~8!fVt||dÛfAZ)t Ży2=dT mŷcsx#/]FY֖|٤WW &|k@Z߀@}F?kY^0= ֯tjBmbԯꅐzX+> gg 9ߩ)o`Q߅7Y>=D&Ճ7,z_-Y0AVc]'}n^G1Y[qm8 WQu,6i4GI4;/E3fG#7/u~حv5!=r8jsR@J.LY!N󢃛_dկɟ9z=H^ɬJYwCD![%LYj9""vN gg 9ߩ)o`9!|g#Xr"%w.05֕GŤEW5h+T{IDQU7Z>)z :#BӘ&T:NNbŋ NENxk5^sۓr DŽĤiU#U=p,z_-Y0AVc]'jQ/U,WjRBŠkz X2YWIpOY[qm8 %e#l80[EUU"ೌmfihkU.O UT)Wɽ.VoPl֍k,( sܱQnj^Zz*]#FLWƆ 8RZ|%c]6)%3j +*_w]}FRz]rr:M$+܈|jaʄtguSIs\[1QiZc[9RQ)QT{1>OUlR;嬕6~=Y0K$%W&RL笑 'z_Q֯ _4Y/iE-Et}#k-ߖx |ſFf_L/) *' gg 9ߩ)o`Bu)9 ]1,/PZ]Hn]ej'S{~~Yoz1s{9>PLzoDV89M[jՙUiYhp^j#[zVNʔºW 3Z=]:T9JA1K UBLG 3]DEU_J4(p^lKznDDS W)k{vn88LCcՊNhj'܍YH%UynAUWjUG3ڏO⋫o,E[VI GXR%k6F q/\"#r8STIآ/`=U/Q,su h+_1_.'Fz1zQ$ _4ͺBI6U[-OI=U0f~9OT{9]܂=ٜ7 vg+ *ݙCr frP܂=ٜ7 vg+.W^#Uo"9SIxL`s;bssZ^='NjmVd~lQTg yR:zxQn8$vCU7J&@nVE\oєE]Y//UM]wRRJktr:b:du mŷcsx#/XKQWQQg447 "&%fWeƍ-T4n~Yoz1WT%:ɶQ-j"^5\Z:  4FOd5L &jj:jEY !XDM""ܷp<%m::!WVC"I)k+=gjގzk0yf1YK &Z5Kb~oxlKC1.N:THN=}lt5 5 RUQ7 eꍅ%QQSd6Ī l3Jd*ŒbUƬVrZ^Y]螅*醄J%Y#PYʟ%<&SOY_w8qY$U46"\!Uqre$zw(9ׯ_M%0j <5i=@Yc'1<T7BsSSA\8=583;j"z,[~1t5^ʴV8t+4[+}'!MڣYcur;Yo̴DEK؋z}kAZ7jZFUF^H.ifͱȩ71" UkQ78G%nMk:kpd6 Gؼ [*nVl{a9Q8w/k*-R"+8U5.Q,vur;X}=Ŝ7_jqg#ڣYcur;X}=Ŝpcy!!c]vܾ4j #a]}ע6g+,Rp[-NYL9x, /zvfl\HQ]C?e75eSkZv0h+)-~nz\z5 M>,:=JdVCUjVlgTzrZsK;cri%zY"EX ֵ8UnD#FЭ^-#HDW9UkzE'L)&svMz)&sHQAͯӯjQ/U7]m# kߔּ;ٍI|IQ.''+KᶻĄſb%q ⏴Dj:"ظ+V"Ѩo&REjLu,k-T_j\~/T_ܿe䲼W[(MjBM*%Rǖat&^'W1bu&ԅqیvhH(p^x %'Mcz&,U{j*Ҩœkvno |GZ/JWPnEjxpZz5Quݭ>*hI?6ZFAи7" օmv.(ȃkqDnD] #r h\QJXubjJ<ZwaOBj'*!h[mSrmv.(ȃkqDnD=)Ts񨸭jut7E=Y1 X)`,\o:MG,$#Pj1R#*|' Hr/ ]+}ƓG2]@e#N;a ^"jM1+GED>kB܈6ZFAи7"̮ 6chׯe H[]gՖ**#r_¤X1Y0] |I)jTJ75}莻נGƥKAKԿJ՟eD}!%u4JNFDb,pJۗUQ@|L'f QUWaxPY$+4Xp۱MP@;b5V=e"+e)%' QmUEDTԑnIkqj\7?mS~ˎHxR"Tޖ[+d5nd%ثR au0y$GFDw[~i#Yk Z>N"=ݱUEo$eWxT[B(nyIwo6C*KcyR]ͿPXmTzo=⤻7~%ޱo%69=G:Nt16=|{IAK-ͻPZOܱ۵i825SIۡ)Xx>B^N. [H ]{L B#ĻBUqre$zw(9ԯMN//JZ&qr,BVj\]\"ƩvmWf)8ɉy/K:jkSSRF1f7B*^lXhP' e4̤`/fUPx_mA9?RjQ\"򆂱cRnD.L.1Pt\Vb^V:- su’90s[b@=،[M0^F=ƅqEDDYw_!eXDj"D|7I>54}vU!zB凬)XzǼ5'H==G IRԺ"20t6o.2ujJ~#X)XzǼ5'HslL"{UJ'ǟ 5n檭dD+-~ie턤;֢WD4XUI hRΕbo~֚ ntH`YgU29,A/앭.

e#{7&/;"/PȡZ-g2D=N_Su9>2WLy=9XgRܞF0z|+y9Z [ii;SgxFW! qnNʩ3 {Kb]TsifUnm3ʣmͦqTm3*6oQ86gM;\m配JĎ.>f)G~8(Z+;BThvRERZZ Aj+nm3ʣmͦqTֵ+}="j% 1sdxYd61@8 Yz>N;v)kqt1?5dYǫ9\S2+͓xQi֊TX+:+o^ö86gOmiK*[-owXer,Wvꪾfvw$u4)gS6 ՔߔM$,pJۗUQ@pQcMs*ғgg%ʆGD$']j)zS iu)8͛t]v31ؑF[U"yM*/ iHUfu)7aA>Zf7-KL1Ժ4T5GrlnGe6w=FMv]QisnGe6w=FMv]Sυ}I2 r暈_yMZ;jS1t ")\*WXNI".kSHQ@GW^{vEkt[ɳVoMLCM:$>}2Nl®]V엡#ت3W)2j ҵr">N;vi+v]uשc=_/]OTJ.LY"NE6֯\|C.cBnX;qp`]30DBE_8â%3|j]_%7KU쓂h+E1_.I hR&m4 ))tH`YgU29,A/앭.

mu[K7-m/Xܵ]cr>mu[K7-m/Y,TvJMG+]r}kq+vIZUZ٘ia9r*^o][05jŕb97gT@G~8!fVt)<+섄9IM|?n4kbBl79\jZcUt^DOY7:_:wKSXn|kߝ/Mcqn7~tu5ΗΦ17%KWٵZW8 AM$*IމrV^uK \3;"h2e'sTb*\~Uz\/va=ʻSĬi譅nDMSq5ZL&ŕV1]+{NsQ\]g.孥|kLV_6嵤Sq[ZWYSr>muk^*kIr N'9 SUof֪9Y&ZޫXTTr{޷"w/c* N+er~r/*zxUo8ֳ"m*e$W-r^wNőiTc5DT-m/Xܵ]cr>mu[K7-m/Xܵ]cr>mu1\\6riJNɭ΢R< favz;Z :,xƩf5QPmPtvl6NU`/Y穨t)!@rޭ8o-Tj6ًИEw_x}s4Ӂb;I}Z Jb*HFaI᲌9{6Uz BKt'"49r"᰼ʬ6!9UYpvڡJ,^96NӐ#ט**1M@i{Fd +.Kز&lfQ/j}m[K7-m/Xܵ]cr>mu[K7-m/Xܵ]cr>mu:őhTF}ȗt솓Y@wn~se4zw(9үN G3 $ZG"Ȳgfj"v7pv/Cf.3omq~mˌ~Wl6ƪQQfyv(5URx`5)n53 d)u-g*Xkby~s5*&ƅ-MNZٓUS6y?xof\f߳{266̸ٗͿg em?xm.3omq~mˌ~ 0rmTڡ2e`hR 2")ٖVs-V6j+a:8]4ZeDP뱖m-Ԅ1^-WQu,?Y4 #դύtVE0\X{l3uR+H6.\#2EPT MhV+RENk-Giν^^U0ҝc )1y>ҝc )1y>ҝc )1y~:,^z=q{USܣ ov}AzMCyN:n_ѝ[7BuuF'AON[iKƊtU[׳=o4|XCJw^{4|XCJw^{4|XCJw^{4|Yzz\1WzfcFsjpۈQU:#)B $Ɉ'Y" )1y>ҝc )1y>ҝc )1y>ҝc )1y~";/=j6$UDlݬroUId.3l/|n,cTL)yXj'jދq!4Թ")OYorl%ig),MupgƺMC=UC$X=_ N-8dj|5?qT%kiNvkiNvkiNvkiNvԛ4Wd]'J.LY"NE6ԯ3ЄW7wN0(,݂PqspS$>n$~?q{jq|[.:c)sE@%/㌏8"@l%ig),MupgƺM ŭ'i|c Uɔ9$C ިկ3ЄW7wN0(j(X+CjA͌߿!3 AlUt69ɲ^[\Uk+ЄamXOSA\=58N/F&b#Q!GM V(t{+W*p' mŷcsx#/eu/gZY~#fA]\$zAvk~_dFUqre$zw(9֯lڝdt7+ z ?T]S,je`EKVp%% ^[Y]ljX gg 9ߩ)o` waQy 9k%: á{v.Fb@ұ"$8LsܻȍKN,% l׽.;'^h֪"ȝ~Xȋ{|*x-fI%#,4USv#lj5"9\*VU^@[7872?!WQu,6i4GI4's]%?$Ҹ "4zL笑 'z_Qׯ웞 tFw`e*g)0!Qu48ir^N [RjmcBk益 t"#n^ `ABNpc h+Ƨ \j*""^vFpOKTs}GwЇvj)KD`Ot5Tj&̳rLNF?7 kw|n[/#u 1yn@Crw^F5b7Qr~G*bkCqB!ǹ[/#u.[?GJWF$Uh*l7DV+}htOX3.EV{gso@Eئs,VjܝT\!ޜ1rsQʟ%uC<оgEs߾#o=NJӞWs7*wN{_px9=qtn}S;8IL!Mp|xp37\bջ5rr䷁:^4j=) ohw*&Y nZ/8@ӞѺe+,nYg}=t ;9VYihN{Fws7@ӞѺe+-_Iif+rM9´|4((mU+9ЖXcDaa}8>8*Ե;8ވ_60Z'ALD[B<`^޼0in٪5P꯹ړlcr^zhۭ3mGLvQ9]n~Wk3mGLvQ9]n~Wk3ϛ?b8 U;Y+8!=LZ"uFa^#5)٩UH,ʢrgYWAKPNb˱+Uȋu[]mYͥ)P EE]ҔY #=f7,{{VYihN{Fws7@ӞѺe+,nYg}=t ;9VYihN{Fws{z|ܓii^+FddsUVoª֨+E1DBF-d|թjvq*oͿPr_ !\Kn-_q|Dm*yIÚE&1є VDHM۪=)7[j?rg+ڏܙg㱷TtE^Wk## ,c42%FlJިRpG5KQUsUzY~#fA]\$zAԓFo V[pg"'dXqylm-a/g>mGLvQ9]n~Wk:oe:)5zϊG+z]WJJWN,!_#xwkk}F?kYjU RL8FPJ$us[EIQ9]n~Wk3cjݨhT3аED"y<{SMEi7*o㿸2g=da;ѯܩ-fx:̦07t^[fq H>}S;8IL!Mp|xjRt̤|V\3u[mG!s6=g(j6e%a^jw\FRE|G>WvQݻT{7nUۻGvQݻT{7nUۻGvQݻT{7nUۻO6L+<))#"{ڜ*݋oG_ bS򛤳T̕KkL9k]1l]7Sd횝}#5Ezܺ/uF_w*uFʣQwrTnܪ=w*uFʣQwrTnܪ=w*uFʣQwrTnܪy6va)b2$WW*݋oF8"1qA2䳭,e?EI=ZLI;X/~#@*2g=da;үܩ-fx:̦07t^[fq H>}S;8IL!Mp|x,Y hR"#VA["#:5sW-)t0br6qxc"ՓħO7If< ::!q0ۋoG_ Np2nuwf_zZ#aDjdeu/gZY~#fA]\$zAvk~_dFUqre$zw(9ӯܩ-fx:̦07t^5H,&Ƙ\]k\(œQmr]0vq=B TХ*7LLh+VS~R46UVrmii3,j{׽'1ڇ'1ڇ'1ڇ'1ڏ^,X?=oY(f}^Ш1 )v*9x `i^*6p%:JYjtJ:Z2x=Gs'1ڏţfӆ NcćECŬsW{Mj<9=9=9=9=9=9=9=9=9=9=9=9=9=9sCs%; 3cUҵEl9*.aUbzIRiT/YihnG\vȋ¿`N^ 0h2Dv7%R8VWxU޻MLB[؏uܧYo,KVhṬkM쩤mBK*T5썃`J!%VUij\&eS%#귫UM֌FJlM帀B9VۚktэJ#`]jdg6,GSPURQزنG\pvdpv$x_:C9'/͆5TsD;PsD;PsD;PsD;Q:ub^G׭"G罓'1ڇ'1ڇ'1ڏԢWNc<N5̑U8\rlW =tV-U@Z߀@}F?kYi=vKNU^7"px+.^YjA\Խ7d#u _Ci}zr7Q0{UAuSV FdAQnU#B}FHP+9I 6O o 'JnAlH.K|~nTSx/[+;!6bz_ybK2z69TOuރwGk4mٶV^";sf<9^z}G9kNbtW8߱ئ]nBaUSki:2,(TNsl 6.z",UpZMʤg"+DKS'_e^6#u _Ci}zr7P_e^6#u _Ci}zr7P_e^6#u _Ci}zr7P_e^~^z}Gڐ&̨EeTݨt%t/ c_KvmٌRTzrܜ0֚ؔE (sW«R'"OtX{sʥ񘟔K(cDǩqUOAXkʲV1.N:X'=d_:ÌFJ&OY`kvJ%l}AJINTb],R-[tR!3?y/DWuқ#GHb/o^`*es ʊE&L3fAȻ"aUɱ@sܛSڛ5jb_e^x0sUD>F\F<:]*lrl.0+4`ۀNR&|f#U;I>Σi}zr7P_e^6#u _Ci}zr7P_e^6#u _G< l"7AU5ղРBm#w:¾.D*֨[&! "-ʞ2.@Z߀@}F?kYS1uJBdz@Z=D Uɔ9$C ި֯ܩ-fx:̦07t^U55CFHr-pl:gPW9CPZ&\yɺhuz;W>c:EJy\U%,*/렇 8:9HpQcMs*rn5z,ef hY'G{XwSuVLMDWzަ:=YOGzSxHWJm7j*2EUu݇75>kIcUiXE{UU>m"֫-O:ntUUUF޷!`rWyETj)o{7B/%1j%LLck^Nhuz;WvD_։ڿ7W->n 6(I⨟6OD~~x' Q?_m_*CjTOW'~Pڿi&+v.NP FK:*`pdhG6rW'~Pڿi'CD݃eP3[;QR/C/ڿiUm_*CjTClJն+d_ + N]9[YM|[|m!zQQ$zW} -Fr#(%RbEX+U]`XŋV,vf+N9&s)zvWOA< mZ53#!a:{—o'aח5c$)xnF`k| H=Yr㼞l" /Hq:K%;8]:"Z˫v7\e#FG{U/+v)3=QI⨟6OD~~akmWbvI;&B)Yr\նĢs&5nVu4%j`-[ڲDW8կ֬j6ji [눾/GI⨟6OD~> ,{踈jvm+ SbK4zcɱ|QUqre$zw(9ӯܩ-fx:̦07t^]fq[ 5A ITQH,n/Ye2,Ќz^ z1x; ¤c9Qc 6 ữګzRJF[,S RY;芉vj7'!Xq?+'cc81V?O?ΉhKU8΂[ {*[)yjN,U!:"#QxnU,o*FjVfzCaƃ) Hhq?+'gRڷoDzeFti X{AYa8OJ-=ط~B-[7872?! 4e- 6+[eLѰVKܛo?cy81VpLŨa9Ez|Qb/t z/C!vejyyKz`a5FU ,Hh9EnjlՑ$' /C8O?ZzYNj$tʋn\5"\رnD^kLELHFdh*&ښ{hrpܟ䆋z)8==)zFeݎM[D4QdutYAzMGDTEUK|I  \0=R"LGwBUTF߼D:ZUxTw%=GWe5zȨvZ^:^ݓ}*[lbԊQ$*9{QVj*RE *f1V{URfR nV:toojJE{ٽ}"!YJf}ԜX*08/t-X!:kUjk8*IL6J4' 3A^xUwo) x\^Sֲt?$QG' P.]ww!R7q?+'g\Yx|/Cć)Ј;7٠)iYt[y1R* kK`gE#뜦 좽>Ұ_K@] "lQ/uʗIsLGBYE=g1V?O?*Sg@QNHH uW**iCGރ}b[$zcɱ|QUqre$zw(9ԯܩ-fx:̦07t^[fq Q|W1Sf[tU]ukWzWz4d3KNmmh ,s"*x%RM2)'iƱ IXmAx Ai^*CkѸDW&2'Aiz\. R3LtW}\U_I0mrʪv}hY~Z;V %O\çfڔDD&)x!'!ȩMLu 1?1r\/#uS\笊ܜ ްU8of|p U$t%H +I?i 7=ݤvZOh-'bH1YTՒ^芽w)+;INVuR[ttVU0R+c:"]Tc>[;ȠmզdCD)&wݴƱ IXp}bW~Ds ȱz읽ȇĢ" Nۤ~T8T4?C%Z"%ת:PޛGI̾aM-5R"" IXmC^+|8χj9RUW-뾪J.LY\c6/ J.LY"NE6կܩ-fx:̦07t^[fq d]HVmKעuim9K앂">N]r`G~8!fVtۋoG_ X7um+бm}A./Ng]Ā3;;C:F)Mppo]&pQcMs*q.;6& Πf=EdO#ynz {>%4lJz~];a,zڷ'8h%W&RL.1 %W&RL笑 'z_Q֯ܩ-fx:̦07t^{Q Yej#wcpa-!iZ:c^ֺy<28\ bCb:uRe1 -pDZ[wm)e}``G~8!fVtۋoG_ X7um+бm}A./Ng]Ā3;;C:F)Mppo]&pQcMs*de*}dTg"56<>3W%L2L4GBF˼]#*għO7IckmBT3D[υx+n|^s7^u@)&svMz)&sHQAͯׯܩ-fx:̦07t^hʟLS,!9 H/H|WƜzޫJ zCb*"5-s(GA2fɍro7qcAjV[BUr"˭Uj:|Er(ڥJ3-+3.HǥʇG~8!fVt}:&# XN5+@P˱b{ |`- nq|odB?Zz"^Q7S)j> Ejz wVҿ] ڷd+ ^uLH3$3K { nj#Eģdt8Ofʊܼ7MW~rBF19nDMU2ZFRD.3ŀ\\I3l_#@(\\I3D0m}GЯܩ-fx:̦07t^.%`yJ՚M }%>(CH+ND]EU׹`9[DLNTkzb䫬o|뵍;WλXo|뵍;WλXo|뵍;WλXo|뵟fAC13o߾#Yޫ^#&aIba6(_!-ܪPgg1PQQVS aOoԅysQ/Q5N fVN"2#w Uh /`.nUk4k(5r5ƶ(,݂PqspS *hZ(qbXnTZKl`5; mŷcsx#/ڜl揯ե8ݒCsv-_$ YdXQwA,drvt`^-o9V봘gg}RHgSBxE13i]YMK@%e"El(MW=r"˲k6H,Hl~UwJb7p9r;g v D1zՋ.UIWLGs-KaZQ*D㥣5n&MzkPl+ԕWe`K,+euǬ7q}R+"_?hKWEjxcG*uu;w|vGwkw|vGwkw|vGwkw|vGwkw|vGwkw|vט&eoίMSZC4|7R,E/][Qgݫy7Vo9N, UQUէw **#/_M- l#/r9UnW)9\ 6uS#B3dmu_9ܣ ov}AzMCyN:n,)#'Ib mŷcsx#/,z_-Y0EVc]'i_׮m[ityzs:&$TХ*7LLh+VS~R42JJ6aL/)`pުV'Ht6jyZ9Y'+u_ cnrY#QcKD33rNYUhNF|6kֵ.^5^G1Y&bK=ŹP}9Zl+/֪o^Y6ZNT9ț)/OIjTD6_EM f%s[ռv}ڷunϻVnjrջ>[Qgݫy7Vo9Fݟv([ռv}ڷunϻVf5?zs9db+؊֪!jxFKuꩳjor(M9t~ U?16 C^utiDvn+Zo}Z "4Tz^ܫwa!P `O Hj*mв0NVt,ݺ_)u *& 1v-/ܪ aLSqc95E\\I3l_#@(\\I3D0m}Gүܩ-fx:̦07t^l ,G8(?e=|jr.qB!1!7 8.l 7&#%/㌏8"@||dÛfAZ)t ^-o9V봘gg}RHgSBxE13i]YMK@{Ī~gs'=Ǿs'=Ǿs'=V,hݲ{r'KzkP?vKuןi_׮m[ityzs:&$Jt~Stf#Rܪu_XoR3l$ht9c9c9g 7*%W&RL.1 %W&RL笑 'z_Qӯܩ-fx:̦07t^l ,G8(?e=|jr.qB!1!7 8.l 7&#%/㌏8"@||dÛfAZ)t ^-o9V봘gg}RHgSBxE13i]YMK@|[.:c)sE@}`մBŶY4 ׼9v%:|?)K1YT_Apu]sUqre$zɱ|QUqre$zw(9ԯܩ-fx:̦07t^l ,G8(?e=|jr.qB!1!7 8.l 7&#%/㌏8"@||dÛfAZ)t ^-o9V봘gg}RHgSBxE13i]YMK@vuaqo-~F% 8vJxN; $I,%뽥 Vک*^uLHؔ,ǁgQQG]8aw:F Uɔ9;K&=D Uɔ9$C ިկܩ-fx:̦07t^l ,G8(?e=|jr.qB!1!7 8.l 7&#& 3741FY(YH4x`,z_-Y0AVc]'i_׮m[ityzs:&$TХ*7LLh+VS~R4>S삐a{uUKV,f[`T'Gܜk%d!%ֹ7ׯr__DXhʓfo9D* XIFؔ,ǁgQQG]8aw:F UʗRI?b@I!TPsk?֯ܩ-fx:̦07t^l ,G8(?e=|jr.qB!1!7 8.l 7&#֢QH 8÷Жa풦-YOꕀ0hvf.5эvШR%-s~K*<`#Rmɇ7R &5R8@7 [Jt,[jEsK-{әi1 Φ,QbfA\ I*%;;YrQ/^26bː8Sќ\[roqF[ڏ-ډvQ;x|7#j'oڌ⣪jMr[qQe3FQ6.T|-ꑅ%s\ָUOl}}WBWr6vnFN# ډvQ;x|7#j'oچmD;P܍>GjCr6vnFN# ډvQ;x|7#j'oچmD;QQbÿDwk%aR6\`Uk,HI~"']J׺ #J/M_;3Q;x|rPZl*hgk1=glj Vqg[Hpsڋ[ѭ~Rn$jnMD}ee2jiXҏUkF [%:|?)K1YT_Apu]sLDk帔0eir:Tk(L%FTt{vsFN# ډvQ;x||kO*Kt7USJ! N،ұ%![[4zcɱ|QUqre$zw(9ׯܩ-fx:̦07t^l ,G8(?e=|jr.qB!1!7 8.l 7&#&;`^|pID"5S}wLRCdsUw"2J$G9rk0,z_-Y0AVc]'i_׮m[ityzs:&$TХ*7LLh+VS~R4> Idfo%G|bI,xrQwӐpT6P.Q@wTnP:5NQk "5QoM𣴞XLIث,EUUU b~tXCٿerЇS`j*7v ݂;y7`j*7v ݂;y7`j*7v ݂;y7`j*7Ic+`ˢ" /f|WÁzvռ#WiD辔-@ gV}%54 '|ōʯQ4yv@mܭMq(1Lc,*F6oGG%׷#p6) ȎGuJi'-<)MY΢pÃt^"=:H. kOس؛'#[w$~8!]v{۰Tpo5FQ@wTVghwU#DEKؗ\5!J>:^-#Is*UUQ ɔ9;K&=D Uɔ9$C ިЯܩ-fx:̦07t^l ,G8(?e=|jr.qB!1!7 8.l 7&#`#Rmɇ7R &5R8@7 [Jt,[jEsK-{әi1 Φ,QbfA\ I>r\/#uS\笊^-o9V봘Jt~Stc0#I?b@I!TPsk?ѯܩ-fx:̦07t^l ,G8(?e=|jr.qB!1!7 8.l 7&# =Z`-\r\/#uS\笊^-o9V봘Jt~Stc0#I?b@I!TPsk?үܩ-fx:̦07t^l ,G8(?e=|jfIbjI`xdIYmK)%b' cךJ +"+ʨfkp\jN䆷'btr풘*r4סaA@ֵ\]t95*j4' ܘ+L W,CXǮʽ<@7 [Jt,[jEsK-{әi1 N6c;yJfyf#^juWUTa97bE*pQcMs*ozXվ AXZ3b@41X&Xl '*tUkSVB4m ikH4EsV^z*2g=giqؾGP*2g=da;ӯܩ-fx:̦07t^\!YCRTCr?x.ߨ{Iwo6C*KcyR]ͿPXmTzo=⤻7~%ޱRdH[ >5K4*f{v"܉w|"q eTLGVܺBr{-16=|{IAK-ͻQ%ޱx.ߨ{Iwo6GPrnrE)W]o|/XmTzo=⤻7~h:E-?QŖn{* sQWė(i{e⯉_Q%ޱU }xћ Jw_LWӴ/[`j EUxU2VJNdOK*:0j"\G X7um+бm}A./Ng]Āԋ26Y7ѵ"̸geō?tmH.,ojEqc~R,ˋ~ڑf\X߳Lf`ft9tkUvoܛ$++W*c'EFʟ_ l[+oR٭^di舊7Y7ݔZd܎mݨٔ-UJݜZ[ pvU)5#HBWR7#~wᗌJUEX2h/{*D,ZB3r7 [Jt,[jEsK-{әi1 W}`@ލ,~bpj]5/]7k1b"%'[R,ˋ~ڑf\X߳Ny|,YэUNڍU5\Jm57*UWMQ֓[=¨#Fw%=GWe5zȨV_m# Դ)g5F fQ#FnDKe{R,ˋ~ڑf\X߳Fԋ2g:ªEE6"u梪x:RѫbQQUʛғz@}`մBŶY4 ׼9v̲Gr \=rx0e i!Aj^֣o;^$Y=?tڑf\X߳Fԋ26Y7Ӭ8NfUVLN5 ʽUF[zpWDt谥$` i2҈ G*]z0 ٌ&[v?t6Y7ѵ"̸gM*߳̚MVU[%dXMK둼_DFzN/CMuM T Uɔ9;K&=D Uɔ9$C ިկܩ-fx:̦07t^'ˠך <6L_㼴 aZ%!2Pnb'WѱךN,pQʍk]r]u&;.I˹7Rm#zԛH컞u&;.I˹7Rm#zԛH컞?&,6soNE"+mseW*!Wx eTLGVܺBQ߅7Jn>w(L5^]bvڪ5'Mv]QisnGe6w=FMv]QisnGe6w=Mki*Шq{a5o.U~ԍ#5KL>bf#Dz9oU%Lԓ"/T$ 2+Dm (// 6w=Nѭ-Tkܟǩ+^0+RsuE9NVP"~r$E^˔\zޫyi_׮m[ityzs:&$Y$/Kb؅T1Ha#Rьh:ZcDuj}ԛH컞u&;.m*9?SJZFi]jio*l%JLRі,w+z< Ży2=dT y~RfUWRXpZ&*QPl~un ˍ&x]Su&;.I˹|cͦRp \T+CiSH9목o}`մBŶY4 ׼9vѣi8\d nT[Y5a6W+[Jf4{Hb"lSu&;.I˹7Rm#z_|-zO͹]k}<+γoLJ&Vwʜ1_wNWRTjrM1s]wMv]QisnOlzc,&ƹ.z%u3.7^-zc`J.LY\c6/ J.LY"NE6֯ܩ-fx:̦07t^/'>ؽuNc=ITYfQݍWEW*vR}jDY⅔{,ʩZ+ssSP{wpsn8Q hu`)M- nq|odB wVҿ] ڷd+ ^uLH3$3K%,*/렇 8:9H*2g=giqؾGP*2g=da;ׯ 3LJ1zVi-AVD)UupLf-W*GLG: kԃ-Եwʿ҅iM]|;TeI<W{wpsn8Q hu`)M-82Uʉ"FIN/GfRM^ ^-o9V봘gg}RHgSBxE13i]YMK@Zr"phL\MUUuH"ؤ_ Qݝ$7*zQUWBÖLHd.x\+!\aNSSq!9Ո8|@bS򛤲3%LU{𯀆5)Y:B""\[3I?b@I!TPsk?Я8O[Usg{E{o"uOV67kaqN| #+=sbݛ9M &/O?IAǹclvJD$M3! K%z^zEDFCVҞ:bj=9}&8Q߅7Y>=D&Ճ7Lc-EU^%AKO;cɠl"J5Z}1jJF_Fɮ<9hRU;( [^-o9V봘ig}RHgSBwE13i]YMK@aPjjX$5\"y;jIfjFnWoo#uæ^s!)&svMzmP+'JYzkL֗EA-_I@n5WyH?=3rAv#W4NԽO"t}(.$%0X"9\9oUU=P,fdr'eQO\ Uɔ9;K&=D Uɔ9$C ިѯmV"Q"ѫw*% ϱ-ȋ^aj[wL-W}.iotm0^-ž}Ѵx6Z]L`]jcCD4"6/B_u٪v\Q|ESc6}iotm0^-ž}Ѵx6Z]F UKaj[wL-W}.ǥM řص7ow451@PQVv.M돵Vj 5[$9 èҸڌ4{;L-W}.iotm0^-ž}Ѵx6Z]F UKaj[wL-W}.iotm0^-ž}Ѵx6Z]F UKaj[wL-W}.iotm0^-ž}Ѵx6Z]F UKaj[wL-W}.iotm0^-a*%;%jo޿tStz:*Š973dG,E_6, -N3Qͣw{0,Xw}g\vZ"hڹub8Y/hTUg lSM YETj$yxrߗnE[v"wbU:=zD{W;:v'=^TYc'1<Ȓի 81]t(nK/cŤ7HYF y<E.r0qּJ6+S2خ6<4zR9-m/Xܵ]fSV1NZ/4Gzzn9%A`C$8j.%DNcSI)6H絪د/'\HXW/]o<=;9 7`\Ǩ4:wL2zZ?=^VS{&ePMLۡj`XrȆpJnE]}m0^-ž}Ѵxm(j6KÖ*oE{{DD1jؿ(#Bj;7 ZeY'JBo^^-o9V봘=IH[ v"hIdMz9UK,Mǖz,Hpu w S #25sخ=Si@l=FFQЖp.WЇq^d&ت_]gki~6孥|=lV"5oɩ#X bƒe:nE!+a\{ $ {PϦ9&v'Y<7:ĭՆju~_II?b@>@4d%f%pJvYQnk]UE"_iotm0^-ž}Ѵxy7Sɴ܊x;RN 9~L-S}.iotm0^-1 uD}Up~Y;WxՁYUF/ o_r'Xl,V#"&ʛR ٕ`oFQWǩMkRb=n]N]ž}Ѵx~Kl1]Wj:}cv+}wnqɂb QQSCRUqre$zɱ|QUqre$zw(9ү$d dDlJf2PHQМ""ĈU[p'gtR>LXp~ǡڣԟ~|6'CF>F 7}I7PmQOjR|~>TV5UfDwbXDٜy7HldYKADJY7Dx`d5jiIJCtg{ڋuȝ㱓Qі y6=( D=O|6'CF>F 7}I7PmQOjR|>Tnnڣwԟ#uYŽݬUMė]CFݝ6[+=fN v7Ńc7 f oHՊ ,xOEןF>F 7}I7PmQOjR|>Tnnڣwԟ#u|6'CF>F 7}I7PmQOjR|>Tnnڣwԟ#u|6'CF>F 7}I7PmQOjR|>Tnnڣwԟ#u|6'CF>F 7}I7PmQOÏK+jyFJDXhJT:Nf3bȑQqg<]61W U|f%6ŷlĒRtT\JB^\OEJQ۾rizQxj贤:Hu1Yu@lLj-j%ƁOZ(} ut;DmaՖiQryZ>3d&1A߬7Bq')$o`bR#Z+|`%ft=LpbFz%TK/V5,% "' 5Qnm.3omq~8&0f+I~ !1jGFHjDUET"p/)\]jNԩӑ\{wײj0Q߅7Y>=D&Ճ7o:OE)b EfT]y>s-Z Vjt7b]{]>7jR|>TnnF>F?bڍJ HboQ=H_@Б"-7·]ȅr))x\S^-o9V봘7rE?4QG%Rmm)V$8ebSd}.7/Z3=0EGz4N4{Lx :$FZK]JںA*9ȗꗒ\mTX!EE 3mq~mˌ~of)U&0+1RogވJ_L[$El*D+Uz\\I3l_#@(`YZ]!%) n/W\Y¢Z=p}VlS}vnS7mQOjR|>Tnnڣwԟ#u|6'CF>F 7}I7PmQOjR|rC*]vLj]6)4%QƄts*#ET_SȖY'Z$rn+OIf\ZV1WcPΤf+adꩾJ)Ij4X=ڣwԟ#uJQT|nI<'bĿbE_V>Kė_&J.LY\c6/ J.LY"NE6ӯYZunRrHĊ\:FMɱl$X]#7:-R%p3LtjE0j/eU4La/htWDJEVS୻W}#s|zמ4Q^x79GǭyH#s|zמ4S%WV)EOsXNNRV,xpꪫls,%Z):ɑќFvn5kki8ȈMi^x79GǭyH#s|zמ4Q^x79GǭyH#s|zמ4S uʛz%#7:UD d.BbFc=Z :qV.@"5ER:=kF(=kF(=kF(=kF(=kF(=kF(=kF(3d&1ABNpc h+Ƨig}RgSBj5FDNoiuaZi45{>3C!;/=Sbݬ};HK1]gω$UU\|C.cBnX;qpaL\o:MG,$#K-IsXmFrQ[+;]AǭyH#s|{W4SԛhDXblkMzәi1 rC.5Ue6Xh{X9OIS.wUTؔ,Ӂ%,*/렇 8:9H*2g=giqؾGP)MY΢pÃt)&svMz)&sHQAͯկlW8Q"-ț$aMnfxQ/{+QU[.+J%!9;QQr"TαΫd|̿Ԥ7+5l}Vyf{AE#l} #|?|\<YVQ}S;8IL!Mp|xI hR&m4 ))tHc5 {n'ڃ0oj+eׅui[Sj4=9 UTi0a\CBTE^ bVS7/t#Kn-_q|DĬ6-5BLjoE;#A[IJQ!z^u)7:;O{>%J=[5tzhªh[brWoNτ$7)Cϣ71;iFEۑ{{{Cؔ,ǁgQQG]8aw:F Uɔ9;K&=D Uɔ9$C ި֯U1VfVbzn>7Wga3j9MI w,eE|F-9( r cMWNܳS6}lkPU6pR|]|jFFEXQR! bD^#CtR6@Т蹪fe$GȈ}nRUu?pՋ1pѡ|?|0[2G0[\"]H&3]3|d&1ABNpc h+Ƨgg}RHgSBxE13i]YMK@r/ao>d,Cl:5h :]V#Ѫj%-сcF]'t%_EN,d̬p-Ȼ}21؂Ͷ|ndМ8XUU[fT@ fzElByވ69Y߽:^lڗ.dx.Fܦ7lTSiF}/0p^݃<*}3htL"Uo1zv''b,XzJV#z&47@s-VħO7If< ::!q0J.LY\c6/ J.LY"NE6ׯh5=6xH-ČYN-i,X%RJrw^F?7 kw|nrw^F6UuJBNN=%jR""A-G:em08(ހϜM6[Y& z]5[Sjm!]Iɶ9Q/^MZ 7Ls ùSz ȝu&|hW.Jvڄi;z,E=2U' ^_ŁzJ,4F@j*BEO HP* 4WIsK|Fb^-ȇ0~&[4ĻOTWlS׽T`Ae_db$;M)MOW8%܊ R0*"Njf>#»%}l>F*b6uE痖7!jDDMS[ZĒw]M US޿es;n~ڧz T_j\7?mS~ˆwqSSԕ*QگTjp_CALJŕ5ZTSov1KSTZαr%"DPTE1M2Z^J ع+RRsQUuȈXJ ɪ<̌ݲiR.ixzX*ֹɽ:6-٭)ie$ڪ_$⟮uM9/O҆O[/#u 1y)A:a5/]9mV&,usV)ű~6Ocx$>n$~?q{jqfvw$u4)gS6 ՔߔM$6XbJQT\;dEr"!2vk$Ԥ8DUkZ'n‪-K;vr frP܂=ٜ7 vg+ *ݙCr frP܂=ٜ~(*Ng+u^'g|fiz"r5WM{,?M "#ڊK*`8TMW>LI>ysZƹaz]z|bhs6Xf'9]zMNKZ4V$k.K|VxѶEA<4VYW:~HNM^[Qڵ3݌7&IVAEʰȰ!5Qw@drxWIHQ; KSP'\TMeh VF5HN{|y#7-ƔZUD7և[/#u{<_ʾ8 kw|Enrw^F5b7QW UuI:j$h֢zQPT9r4+-rqMz1GW*F]_+6I}ʍM(}-1yn@G nr7%mOۢ/Ԛ% [;₭"}Mx@Crw^F8&qCxN"~7Q{m7"j:UilUsI, r jņǢ-Ɔ܁1yn@Crw^F5b7P܁ n7 kw|n[/#uVYfXىb^MBRl՟a."_v޻W *+Yi+,{{t{>%,*/렇 8:9Hƫ܍DWyXvD*~*nz [QU; OQ˹[/#u 1yn@G̥I*Y ͢ws7@Ӟҟer0*u" |c0*}C*C[jUz&&zUOHrX|eCaM-%ȫya!SS( ^V졷{bj7[nU]Y/DkW½7[\ܩ-fx:̦07t^ԡQI$+H+6;r/)+zƏ@% R"Eb_Q.[yW^,Õ{w&QO+1~zWΤqi"5ż[TgtD(2 {܍E]r:fj4N|v3~Px_mA9_|v3~Px_mA9<]mS~_Ge cGBb)T9O,h ¸lN^"':Z r^N,UJj`*ԺTb.Tc5 .c"r-_VZv5b5osW|.hiber6/%,WhTlUcRslf>j*xN{FwsifggN|FƍkQU"p+fJ~ѧ&! ocxt\?u| +,nYg}=t ;9VYihN{Fws7@ӞѺe/ epڪiil"qUT<č]Tjbl[:pߴJ5^xܮWW`@ؔ,ǁgQQG]8aw:FjJ2Kc׬]83͊\*]aa5|5U7fN{Fws7@ӞZZ29T,HQ[3ZW"NDӮbC*.U;)&svMz)&sHQAͯѯzn~p٬ /MewLw]{'Tnܪ=w*1/w*J'H']OUS}%Y_Xٔ@f=ZF񮓫HN ^<@Z^+B_9TKXj|$)V\iT\/{'Zc.q=G]j)zSu9>2WLs|e֮2Zr=Lf騋n=D&Ճ7woL9fa4Ifvw$u4)gS6 ՔߔM$ Ży2=dT]sIO_}>''ħO7If< ::!q0J.LY\c6/ J.LY"NE6ӯzn}p5]a.U;IFRRʽhX~-T3Y)N6hYʱ[ d^|QO+1~zWT7BsSSA\8=58fI n=&nȰlʤB􀨈wviNE#rM^ ŝBLN1jtE_nLen LL^-n2~ 6,.vQMτeHHHM S `J] 1.Wk UXW%Pqy[4G~8!fVt܌kTT1QE;u2k"t$G-R!rUWw7xNYzT- Rh첇zZh+glk~R4'KzkP`?w&? >~ MS{tx~Ri,)ͬu6tTnYoD߄HZ}hEИ"9Wo`\\I3l_#@(\\I3D0m}Gԯzn}p5]a.U;IUN/!ReVR${wɇMF-?|XYw!\I/:jt&*DN!&haz"]tSؔ?`^5NU;J`NPT,:Fem]vp"pZZ$V†r!`؍j W6MkjȪɸQ"| gk“tG"lr_-k _UV^5$˦1`-8W#{v}*> \s^\1x|?/gLb6TV(<e^萠="#t%Sj8=9=9=9{ %8d)hr"#ZӔ2t xw*l D/xkW+~ MSy1"&(6L\݋պ)KF-"jvGCbtExN()F٥#WJ.LY"NE6կzn}p5]a.U;I{Qʱ,eGU[D[IU\ 2<:nyX187:_:wKSXn|kߝ/Mcqn7~tu5ΗΦ18bk?qv&zi|k1S#fz)Gŋ\Tc+Z]j 'Qf/8Խu,aZ]]e3v}̊DElMF-?|XYw!\))m34J&V&p䥘雯sMkGv5N%ҋؽSprުd0\R5 bu^;XBU s^ +]XX9Z#~O6ߊO6Υ 82tCG*"|(j.nGT5'Ω*!|9g._ ݜu,ZZΨ(8J"舜 Q0ha.k;;=u 77 \$);d4G%w_ɹ7g=.gl9g7,wΰ~\֭Fc5޹4McZhYL8FCkv+w NgT-vz7eM&/O?IAګKBK;gG:HDE\wp99IE߽/_e^6#u _GޡpM:3bâ5oW]D69Xjݘ+j$9h-7yVN?(JUcHr?=;9 7`\Ǩ4:wې7DԽTqjW_rquz|+$Ϋ₩|Rv;b>Nf;Vq7g=.g ɻ9as?nMk rn{X\vsܛ3Obd>U&mGLEƷbmqqgaI‡ٹ'Nb̒b) %鱾2ɻ9as?nMk ݜy7ܤ9q!xnMk rn{X\vsܛ3ݜ7&絅7g=.gܾ*6wBɲ-G]؆,ʤ+]-E{z&D7 =Zj՛r< 8z7䷁:O@nxzKWO',U}_W`9FtG9ڏƯXzGȮXMz"3 2 Zհ8|[.:c)sE@\]4#< oUO +W(X d wsi1i tVroOU*m1][)F˺4G-ȷ'I&V6^C}v>5N7zS7~tu5ΗΦ7:_:wKSXn|kߝ/McqLN;?X\NZΗΦcFU+~u5b\'>R$G]عޥ:+i{6WX*CQ"(V98QL€4atx)-IQq訫*\|~^36 }LBI#ʻ܅,`T9j6Y6Q6)C5H_GJkFbI!TPsk?֯zn}p5]a.U;I>ZOҒikѿW\9U=C|TW5bvmޤYP,G"<{NSlzNÝ͑wy㺏fݳyuͻf=v{6m77Q۶o36[#S>MT Dcb5R9V)jti8)U:cؼ1Dj/60ڡ+C6+CxZ^+B?QnS'oβ<96*H'Dd6;;."튙ZF$W=^ gMI+etVg8':vLT)Vʧ|ltc"=F;w@cI*5َ"Jt!!:1m#&, OY|W0_:+UworbZEEض\xv׍jed o6UTw1!RX/WOYMƱ_+s1'#Za G&_\Tʷ1x|?/gLb<ܦߨVY,3bIGrlzש EsKynZ'jx^Nh5ncCV^^ըa_Kdٷ])Չ\rG~8!fVtL,l$Jr *u>UU&=?Z NjZN5ڇUgFح%'2&8:d<7b$;9v"C7b$;9v"C7b$;9v"Cj\HӔ;(x*ȑQ\Fܞ!b)H%bD{nUUDXS0틡a aOzXDT:!!!!!!!<"cDޖNaX#U Joh卾+MDm' irODVS33qr]O\{>%,*/렇 8:9HpQcMs*1qAWc*頬O;Ir鈭*5 (åws6cAfYDI԰L^-n2~\|C.cBnX;qpyhi3NU-ufJW*BG-eXFSUJ6w2QTDD" $GErzd%/㌏8"@ħO7If< ::!q0>r\/#uS\笊- nq|odB;U44:h+97yNzUbD%x:+tEaQ/ W KWvٙj_^G=[o<@,8 rS Fb"%l''SƐz~/ҘƥYuY\\I3D0m}GЯzn}p5]a.U;I6uu[#e'Yc{5 Ŭ~9Ncx&>Wc,մ/tWѬ+ YrqO} #|?|^F9`.`ǮqQkoQz Z>3d&1=1x3 Ft:I@r.qBX s*[Q i_\]ztۋoG_ bS򛤳&EEt߇U8|[.:c)sE@[ktsx#/9T/AYɾvȪZηIg/nxQum1:vk~_dFUqre$zw(9ѯzn}p5]a.U;I6uu[#e'Yc{5`op,zb~*LL"){lD|G6Zo :$c8/kn[RM)Oǃ+IF=SdtjVMETF!XQjJдR$gCTUFN&,EUU_ %Cj"ك)VjtHlO ywǎ"-ꪧ ŭ~8OcxiJFB]XU/E.fulc5s+[!T0)T|k{X&G~8!fVtlGcs}&ŹSq":+( SeTЇYB|lKZϧ$$xTE^$l:!GC룜txO-ܗ _19"w/kotx_I]/nH5~C/TxWԇYw0QPGMg&|O)O\"YjS:%;>i Eմפ  YKH#78x]6NƞU Wy4%W&RL笑 'z_Qүzn}p5]a.U;I6uu[#e'Yc{5գ*FZ,_!rzyjyjyj =iڏ9@TOc|yxQ[^-ȆΤ$4XNV Dn;)f8v(=Q˿r"UU7(D"~S[c nr*/.<Cttr5:z`V^^9{ .N֔w"-9U/id%)~m_*6OD~~8!V aDRB$`]sxNY Gj*ihНp&/O?IA!TdHO Xxc;P Xxc;P Xxc;P Xxc;P Xxc;P Xxc;P Xxc;P Xxc;P Xxc;QʇX޷%1ݨkDKQqf'Q7-Z-lIDsa_^˻u^nKQ%*$RUƝXhq{}&0Q߅7Y>=D&Ճ7\3 ^UbvwWae fSrl:=PcL5]Dju90ÒCroՇ<ӵՇ<ӵՇ<ӵI_(r4}z^*"xVD./ J[)*F Zr7IGR'9P/>ԭ[R2r|+yjyj=Kȥ#1?)OQ\5nTTSPI%F+yjyj?R%{<ӵ~Nl9j*aʫwTJ.X+eie ҰwY/R•-Ti6Um N|'k+ubݛ:'KzkPjeRUĖ%5;b%蝫TQ+W~nx<_1杨|<_1杨-G(1ݨt4NSU4Lv}EB4:OFK#S ڎOՇ<ӵՇ<ӵՇ<ӵՇ<ӵՇ<ӵՇ<ӵՇ<ӵՇ<ӵ/zL"fݨTlܒؿBRqs%Ԓg=d;ӯzn}p5]a.U;I6uu[#e'Yc{57ŁU0[J\I8?e /DإW gW mv+6Y:|"m C,JQK\NUvk[%Y/TMo3tZgYn\8'코 VA^oW\Vf~r+"ă-JD0kKz/VÿEUtX7\Yc'1<< ljRi}ʗ-T!Л-'3v) d]r pk?\k\.A gW mv+6Y]r{]J*ֆuFUSa쥥Q?.aQljMWb9NNvNFc%Ȟ ܣ ov}AzMCyN:n,VJ/:Q6 !S?%. x X|V(f.,DE<7jX)[d슭DEs7k?\k\.A!U3)BF 'R׀V0L!W1h3̾r5Qv;]dm;;hO=6KMC#2},űDӴTvj*^"'Ku PP[  Qr>k?\pv+FfU˪-`rƛT_ӕ }"l[,NJ=VJҐ3u͹;朗,\-!;-2z**}]T|/ S񕨺w^-YR3a9dD[븀91% Ba5U.j ]H_|gDzޮ[XO-ܗ _19",-V8PnjydkchtL81"*'Uji70wKҌk?\k\.CҤyrtj> &"onK+BUJV$ G^{o44:h+97yNzRR,aEMW .>'\9:f+!FVEWi 3fۛsnKܫ¤@eE¹<.k?\k\.Cu EA;(f)Wls ߱KU*2ۤ-JL{QaEK6/,(]D/D 5/u>k?\k\.A gW mv+6Y]r p f`frdXReU٭w/V %]e)BdDG*|7^.UL笐'z_Qԯzn}p5]a.U;I6uu[#e'Yc{5>LLђ,l\yZ}T-+06:c)5j(+j1ཉ1v//\vjhsnʷܫ$2K߮2^W )SOf~'VR:׀>LUENֺNmD^lj~1{C(ֺ+Jv [ڍȋw.f8*y~݃{7`j :w;v݃{7`je}[&,72$DB*SvI>~*wkV@~#t!` e)3 Y_#T~Q1SNT<7`j :w;v݃{7`j :w;;CѸi%zth.D oiN%&#y9?RS(ɉlU_$CEB򬕭F:R2GAvٴ=j jF+Q<&JOB&U~56ZG5c[OŋE]dF|9:]iWj^Cbkt~_1fNR6;cIV-'kh,>*PKrtj;Q5j(nZwJ7FCVҍѫPiFըwtj;SqZS8p}iϽ^Ô%?\bN>"eUL\r.qB!1!7 8.l 7&#%\E|HNYV22Tu>ZwJ7FCVҟ.j4J])Zj4|贄â*UT`n(TwlDh[·,Rm /R -]zfehH0aZֵnKu-EGJqͨ1H+[6bq[7>gʳd3K\XŢO0nɌEKD9~0KTQkVK5ըwtj{)i|`VJV{Xrs[볜菿SUĊ9UWq>r\/#uS\笊jRv4ܭTPWzlӮN1KPjLp~RۣVҍѫPiOY GĔ^"o+U:gMԅctgƊ\.Wc*頬O;IdUK-Jg[}7A^(r\$Nɵx+tيd4rb9Kն,Td6^:5j(\cV֘Jj=N78틸QWN*Ōs~=' +%Q:GKHlG]r*47FCVҍѫPiFըwtj;Q5j(nZwJ`;L:طޭUUAHFths\UILɔ9$C ިկzn}p5]a.U;I6uնG,dzOO}ſ[gXrzhYR&O#+%jTNjkT7BsSSA\8=58r.qB!1!7 8,CY#P .>0l y?lR9@Yc'1<{wpsn8Q hu`)M1sdxYd61@- nq|odB r]^.WdڗAX:3b@I!M Y}ͦ8Aue7.IzqN2/OQlb:%$YWc*頬O;IdUK-Jg[}7A^(r6_δ픪VF&Iui3]&E'ilc Uɔ9$C ި֯zn}p5]a.U;I32ldG`c(*sff݋w$ӒՎar 6l &-Ȏb_hI (FƘk~G]$R`.|7=nrp)4 :=Nت i1Hֱqovʽ=;9B%R2Ċ/_ 8`24rћZ_[I{AE#lL.-P#CW3$MX跬H)3 b9nFު"\|C.cBnX;qpaL\o:MG,$#Kn-_q|D}`մBŶY4 ׼9vI hR&m4 ))tH BB\o0$''b_[Ԍ@wsi1i tVro>Uz2UEn˖-Z[1HZ؛¾GRr|VDUEV}6_δF&Hi3]&eUh{af2椽"u'@J.LY"NE6ׯzn}p5]a.U;IIljG2-ʊռ)LipE/z.:vM|y5zU_9fQf*[}echѕ]/ӠuSIĔ[9[k+]rb]r_dC4V;^E;Y jr"4zz$>sf,W+W9ʷ8P5\N<~oT  .>1eF=ۜ"""5uWZ)#_"z5; ^=;9 7`\Ǩ4:w˜<,߲tYHF [7872?!Y_ Zd+ ^uLH4d3K#oOB+saR."܇ݓṩHz@Uqre$zw(9Яzn}p5]a.U;Iq(-vHIAVhoor&L>)6픻#Wo[D&^Nbj>}'rѰbDTj_Q]*bf mUU6=RaVdDdd1j[e:VJfٛUD%Š %dڛ'7NWL[扊kU5 $v-jCh *3&jo64^ #\qꝜS*BUvO+Q#V-jG=%CWCy]#UWBO+QMJl¦#EёyKKu)j&ɗ6KbrxSxOvFTl-_wD6; "6Cy{;-GZ{چkUj1J˂EUH+rQKׇQD0FK}AzMCyN:n,)#'Ib mŷcsx#/ U:^F4|㻰Qe~ŮEB_h ֫?6ZxQQzQVǨx9CXUYŠKڷd+ ^uLH䄄'`1^o"!ެ0֋YWaGMȴ³1PorKmauX=Si`&1b9* t}7V'cDJUO[t7 * %u6Efk%uq<+vJo)֧֑vh ֫?6ڪv ھWMiIiHjSeU] v | @V;c.D q8ˤw0QPGMg&|O)O\R ^H]T l(٫R&"/`lֽvZxP-jChwlvTK~Yj&*)' EnSY4 #դύtfU"ҵl5s}ג9SYZhdF#kC0܍}'15 "sQ]zs,D55-Ph4cVOx{]TEԩ Åab\<>?M! %v#؄S̋4Dk.^[5eHY6E\\I3D0m}Gѯzn}p5]a.U;IJ:V*=8Qo$0faCr+Ǫxl暔cc7r]Ȧc˻96Yw~9ρY2ɦMW%Y^1🐶b+LF9W1.O0IU!~RCeYd1/X( f⽽T 4e#ج[Pp^z=Eq.ONUagV#r)ϧڎd_DԧѨ|a+>4jJ5S› [,jbH\.K<%RRKWZv<ܴ> \{d + Ӳdro_q5t;V*ٸ"ƍC _F֚>lIGE}UU'-*J&M:~j?wnY W"uxb|6LjYT*F'*lUx\qд|9:UͺEn^SxyY|6j=]ߩn˻9`&ͪ , EsDs\~-kYHml5zK7.p&Æ͡R]oMF;b7Z@FŃ-HU(Hq1r6Sdj!+~h>0j5%}6ZF&2[F2j q10]X׿EUpHֿYιףZ^/|#6_Hm kşfMq2)h$D,1rJ'EIyXLKjoiSѨ|a+>4jJ5CF񄯣PѨ|a+>4jJ5CB񄯣QM{J="rlⓎT-UQ̃)jKUMY,;<0o^%9irtVCo OšnAP]"صKKyLZUUcK5"o F񄯣PѨ|a+t '캯ɉ4X3*DV\V:Pٰcž dlVtXS6GNc?ۋoG_ !#[4$%+-ԋhjN2Sb%ȚQ7Ш|a+>4jJ5G7kVDVWy89@!Ak'X9DXY[%m[ityzs:&$ c4ܕOA2Ve0f68kDjl4.xUJWEGD+GY)wӴi*ؔ,Ác*.uC$-Zg:^GG%襗0nšϩ"BJ]'qaZBsgn_F񄯣PѨ|a+~hN0j>m5ouK:4jVũ}[M kFr}D zHNrwsi1i tVro/`=bI0Mr BuQa|gV:4/إ$jxMQj!+~h>0j j5 ? _F(ŽP(&Ï42|{ jأ㢢vUF&Hi3]&S(^;9 {/7.`k@ʩe7u ˻9~mNsuz,fƫ=mB !]r\?=NHv\8z}ZŇaZwU5-/JƦ&18 ҰH2n}>^w: <UO;0_Qr.,X=uݕU8I "ʋw- W*xr*/LB*-.=zi-'ㆹq~zq~:닒i*LD9TUUzX@nit/$R6Џ5bܻ>ŭ0"Xi.T!Gㆹq~zq>8k\gㆹq~zq>8k\g[^1:8%׀Q"rUyT6 [KZK ۊBi ܳ7v4N KoeN v.d$Vav%w0J׉ä5U:\?=G r80ZcygWO߅7Y>=D&Ճ7͑frB11qA+=1$'U; frZHFj'Y\?=G r85ˌᙵ7 ПI+\/^_DW.YnWbV,]ak^λI͏t5r p7G*.r_USbS򛤳EEtU8\[hLQMDPəkʼnrRqy|p.3Q\?=G r8>tzIga;e쪜wsi1i tVro9!|%*`yجD9O\SQ\?=BrT80 J3LEtG}\+Le,K>YOdlh+V>5h 9x&_-n1eX[^9{$1gǻ{ˬ{g'E@ Uɔ9;K&=D Uɔ9$C ިӯzn}p5]a.U;I`]՛|mMAzҟFݤ@b^G0lH5~U& /m=LcT97TO !HV0h+3{AE#lL^-n2~v7ޭ%-i Vܵ7v쵨!BuZYk%r'h+;o 1\{e4G~8!fVtXS6GNc?ۋoG_ ޘ;L2Zʹr %55 wJvmSb;IħO7If< ::!q0L~}EB4"+Z֪^w^Rq) 6(^wnm0cVN27'  .>1eF,^UlQ_ [\e";96-"C'a٤WY9|g  .>1eFZ>3d&1n [KZK [| Ӵjo:&:lo{%km˪( \|C.cBnX;qpaL\o:MG,$#Kn-_q|D>3,EU!՚Z5ZY2s;;e+v9WEsD:+^[W*FbRi'< (+9 5^Dc;Cvò x!)zYV4g=UsU^"܆eV/{=]̄Qoq,bq !HV0h+3{AE#lL^-n2~//n+aBj[ULJnR_p` +j_źDe/OڝmSyi1 eTLGVܺBѩ|?|pC *WzGI^ˎ b~lb9g!]1kD6j*ȿ7~2x.'89`3\-ȉª{Jٕ9A$y*ƪl|rY Z5,F*&jwυg^mGkVZ옔E5{ksQSLjت/`t>|UN!KLшb35v"Č=rTTWV $NVU+,*W&IgƺM'L/7OzrrBM%' P*fS)&svMz)&sHQAͯ֯NZ*ʉJebFÝDǢ**ʦsS7w=N(j9U:R?r^{%Nmpa˻}S{wڰo5Cr;f˃G\xk #eT8;wVmI6^u 1+'J~vV_alRx<.a+C¡klXPtyS(:jliD[ES9z :CA?N硻loE^'i͖&)DZgVw;*X3 >8_P.q=Dc&Gj<}EoHi;Q+bCvr6vnFN# ډvQ;x|7#j'oچmD;P܍>GjCr6vnFN# ډvQ;x|7#j'oچmD;P܍>GjCr6'vrFwFr;QQ;x|7#j'oڏJ∪C6bGԽSb$eh=NٴC[q*%96vpVk7*QjU/]*\2:V&m!NY>Sࡋ2jR2Խ- Q"}[N sFBy]T)+ Sa٪') &B"o"ؔieվq5_[P48饗V7M,&ieվq5 K/nYuoMCt|j_[Q&oQqEVN'pړ?8ʷ'^X @nit/$R6Yc'1<T7BsSSA\8=58ث ^#\O%QƣU( 97N^a%oQ2cwFܯr eTLGVܺB S>RU,q{CJVyw &A4Z."%Vԃ NǬs&* b~lb9g!탑{ I~x]ikȍj ĜWllUnZmn!n4qgf97*eN`#Rmɇ7R &5R8@=*Fbj`m\3s[) U7Cd9ֽȝ}cѠ6"݂;y7`j*7v ݂;y7`j*7v ݂;y7`j*7v ݂;y7`j*7v ݂;y7`j*7v ݂;y7`j*7v ݂;y7`j*7v ݂;y7`jjW",&mzNdU~" qbul.DkD(j9SI,a#TS /Xj!* h] +_R~+I\fUz0%c -x 2hG>!K 1x|k!I̾'!N-o y>K5_*2g=giqؾGP*2g=da;Яzn}p5]a.U;I;aV3JǨm9&3|`]՛|mMAzҟFݤ@>]ʒi,Ѭlh 3 #xIMF-?|XYw!\C'a٤WY9|g  .>1eF[3c\A|vq=B l ,G8(?e=|jXS6GNc?||dÛfAZ)t FF K qʢXե!V[k]c#iʻIpqjtW ;X/~#@I?b@I!TPsk?ѯzn}p5]a.U;I;aV3JǨm9&3|LBs_nKۤ*k#QW]+H5Si= WruK=k2 ǫH5uxQO+1~zWbHV0K+3{AE#lJ~/Zu$g[MɌ59-;א$>n$~?q{jq:!g |dmu_9͑frB1,z_-Y0AVc]' wVҿ] ڷd+ ^uLHubaAESG#Ļ'k'C šDǍG@Tjݱ+4P7-Yԣaƺ|+ mg[~ aUG{cIsxQjѥcbN&=a(qWx&>Wc,}JJBtHr5Z61쮧)[Xr\׮tK-u 誋[A c֢܈ꪧk 4[Jbaj."z$X v>psk9.Nɨ+WTV"\axsK`"PurjW$POP lHogeQ@Rʾ[I6ߩ)o`!8J faսQ|F:ïĤK>6;حץޡYW'JS1I(ފ՘s]{QREE*=Dl_IQ4J*aX+V[pP²Ft)*QQ[(ZVt{>%9i+ RMf"lzoMg]&uk _>jZFIEF+Y(0i~{LKZ"ƶ]{%qdY6",6cMg&]&72쿹7ͦeɾm5̻/MineroMcs.|kv_ܛX˲6fb̳ttXwj7;%{:)2ϒoTxŧO?nd+wi9SBs+7aÍ wfAeɾm5̻/MineroMgb˲^6͹gY}Ͷn#Dbݛ6ݴ[bun4V1솩*"oou?V3kufv#sܩ:6EKfȵzl,vI,ecJ&sNy@=)i +`Vdf,3 ǀ<-dWb\xsK`"+)pnعȋy`"&ZZȪm2v6v_ܛX˲6NE> &l޽! ^/,b%[=lzkSSA\8=58=)8Ԅfݓܷ"^U`6b:7o}jw~8"N-4q7QKWYGwk:N/XZ]/wQI$=$\\tHr#^KwUV;z:g}+]n7u}+]n7u}+]n7u}+]n7ubpJr'YNx\N 9pJ~n7u}+]n7u}+]n7u}+]n7u}+]n7u6sbwnGOx7u}+]v' =n[ a9ܜ UBn&BEUsNRZ/!i\9|(oK\jiCw|v$.ޙ[+'XnYHr/z-`GYr{(ITO؝n5\JATKNS[yz\[2ʛRZHF"=Q7y/&±IS5V ?`莹ʭDT;WqQ٥ 26#밿I,.jt~eroMcs.|kv_ܛX˲6]&72쿹7ͦeɾm5̻/MineroMcs.|kv_ܛX˲6]&m6JyY#~nɈo; V=ƃar*CcQ"*p!Pz:B=U9Lle>RdؗI`qf4/HMcz+QȊSvs.˻|kv_ܛYYV`BoMd~ᅀ^-ӒlTUKE!Q~2rr=Z,J -T97EaEOŀbX+WJ2@`Yl̫:g%L6Y3Ѩm^,gQ ;9ҋݨ4J5JR"o/Ӭ*֪CBLM2<&QQ=u&ZբM=;~;*TՠUqre$zɱ|QUqre$zw(9կzn}p5]a.U;I,gy2ꨭT]GjJ EFQo: lXm~y3풪U4('= N{=†Yi[)JbUMd=ȞM$g*sRb 7o/Yl&.bRe05FUc_rx TP)HKJ*5"/o4e!ޮ ݌;zv2WsnRb C]AHw7c)w1 3l+ezF[4Tsjz8H53'gXUU|=cqiz2ۼY E߶CnN2<.oV1S44 ƄQ}tFe!ޮ ݌;zv2Wspn]̔rQKi®4O̽Z]r_{ʪ gXU>Yf_R앚>gX} #|?|\<YVQFlHkrw謶JkknU;% ]^ʱ7c)w1e!ޮ!nbKQȯEMۑSDe;iX-藪 3ЄaW7wN0 $yY2 +y/^NbYU&{":8<樘ƫgpsv+r\k~9o"R'L۶BE*uw8N٫}Z$&**\:B50Izܜ75.6JőwC[Wj1=ջ>[Qgݫy7Vo9Fݟv([ռv}ڷunϻVnjrջ>[Qgݫy7Vo9Fݟv([ռv}ڷunϻVnjrջ>[Qgݫy7Vo9Fݟv([ռv}ڷunϻVnjrջ>[QgݫyzT6*++$6\֪^! 7"'jRת&ק:ƁYuQ7]@T*#17Pn:oFq?Yܭr֬z)hv{<*?# |`u~ӤHѰa_U"6-%Z%^O#">6Jb^1/'[We%[fԹˤӠpQeKҌg!5EW/Q/OQ9o>(M3-j>L&lWEw@HFt:6VETEeN˱[pnRb C]AHw7c)w1e!ޮ ݌;zv2WsnRb C]AHw7c)w1e!ޮ!|qxdʛ˰D#0V2ޭuʪu=Wnk]]6Iz"-)mVkgrO ȉEh9FRUǫQ6 >e!ޮ!qtQ%}ݢ5Ddg:'_j-/zsoҎm[&a.KI@= Jb Z;=Pp6~ƲVaʍ7,e֙ yrnZou^r+MP̭6S_V>>At'9])Ԫ]b>#}oUSUqre$zɱ|QUqre$zw(9֯zn}p5]a.U;Iܩ-fx:̦07t^bey^lG,JO}VlkD~/g G 0'N  .>1eF$>n$~?q{jqv7պKZK |fYtG?bw`pUew Lh`YgU29,A/앭.1eF$>n$~?q{jqv7ޭ%-i Vܵ7vYLq 8PD{%km˪( }`մBŶY4 ׼9vI hR&m4 ))tHN-o y>K5_i_׮m[ityzs:&$l%ig),MupgƺMUqre$zɱ|QUqre$zw(9Я^étNnFzeRCKlgtG}I:o]S5w*KgYF),z]'W|0FD߽hx:fӓ1_6k᪭_©hA[BӒ.[y+Knvf6b"9ns]GYȮosNW:fԽV+?|bS2k+W dFWh+G7bY:#o5LFi{VUUE^ gg 9ߩ)o`wiIaKq/v-M]@6uS#B2Zrs5u wVҿ] ڷd+ ^uLH3$3K-+Ws|ZV-(\[1Sі?])@"&'v;6ƫQzvYXF|_R8m6S$ZlUS ܩ-fx:̦07t^hM h1"jB)|ZV,j>-+Ws|ZV-(\[1S-x){O Ƨ(ɺ=МN.8&'U z'ge(t|w'e7ťjَbJųf9>-+Ws|ZV-(\[1QiZcڴ/Z6cͩ'*/GHv9չR jQ/U=dԲ_=r/>V?bZ}JԿl1GťjَbJų9aYum6U6WKRS/+:"\,NTU*6lu;p Ur;܉h0ehIA)yC/m0bf9>-+WsK3kLy7Չ`qhJ^rlݽCxG`F#@4Hh$$UDTؽU<3ЄW7wN0rBF^%;ׁUV\F!c򕊝 >NԘ^a2[ V#鉵NWi1 eTLGVܺBbnTifُ6ҵql1GťjَbJųf9>-+Ws|ZV-(\[1QiZcҵql1GťjَbJųf9~Y֮-jgm5)FFDW=Hn9f5!𮍱W=W"I%Hǂ r@i_׮m[ityzs:&$ֵ\"^o ]+\$c="*Q=%h+*Ddv*xQ.f Z8r vk~_dF{rScUE2٭jr"1Sҵql1GťjَbJųf9>-+Ws|ZV-(\[1QiZcҵql1NyY1 lcB|5i=f1j^}ٺIHH!*5Rς)HP5\D}s@[Iy |boak|s5^˚ɍ2B.GSӊLLɪ'ّ)-+Ws|ZV-(\[1QiZcҵql1GťjَbJųf9>-+Ws}ֈi{لO!Lnv_ ).%2]I&svMz)&sHQAͯү:2xns֥lUjԜH򌘍^drђ %Px_ĕAU%_|IT,~%Px_ĕAU%_|IT,~VWS(X^k۾آ˼k!-ެYUWt%Nc!ȫoSkW3:=ʜfIl4{6e4Vk>/fvc|͒^X{4vi"RuzZbv~梶rvwBU%_|IT,~%Px_{ivIeU ,yVQwcJWIUVz*Dת^Թ./nIۺ//޼] 22vU%_|IT,~%Px_ĕAU%_|IT,~%Px_(P"F5k"$d U|D 7 ՙLj%*ݰT#*Y!K/DTRHEU:HsLćڹP2ʑE{MKKvD-C62Ԍcŋ"pu&o-><~$KXxנdH۽X#8^-IAHuȍ;" #}뀞4Jd*Œ>$KX$KX$KX,w^eUC[k]dq)T "zȷ0LNSPzLz;9xoU0l%ik+tT'Ŗ /Cxu[c2މɤ7@SӆwpNNV_it ;8nZ}} +Tﯴj7@SӆwpNNV_it ;8nZ}}Uy2+܏'k}[הYȮoW9oURSre$zɱ|QUqre$zw(9ԯzn}p5]a.U;Iܩ-fx:̦07t^bey^zn}p5]a.U;I6uu[#e'Yc{5,sE[jی% wQH3ЄW7wN0`YgU29,A/앭.N*EkUQUy׀MF-?|XYw!\7h_'X9VY㴟gXU>Yf_R앚>gXְnˡDD][WƴS HljD^'6q)!^J(;#{ʰwE^pصqTI?b@I!TPsk?֯zn}p5]a.U;Iڑiq;W")jS :% ( #Qr.rUUoU?pQO+1~zWKϥ͜HNj]K;?oVпOhf3+%eʳ9i> αΫd|̿Ԥ7+5l}Vyf3.Qehr+UQ;lNͬF\忬>ՙ]z1OI0UUDMSݙ\|fl#˥U9RJ*E&(FS_6YDq 7D{%km˪( }n^G1Y V'jEboL x_+Ǩڔ~ 7=xnj^&dIZ^ž4 uctUCvcb3Us}UwO cUD =CF+SQP妫U+XZNL>#YZQW1nKZEiMNKnv.,fcRC$yJl56_~#a"nCFe KIq\\I3 %W&RL笑 'z_Qׯzn}p5]a.U;IպKV锗|;gU * Hh s79-O1%;X>k ;Y+ !,JAOT:1S}v"ϰW}UU7JbEKs79-O1%;X>k<-u}>ÏKS)vj}979-O1HxmR#7!tjzoěu]K%Qkj1iz2ۼY /LVF6eod7*TGԪ@y<8=.rQUu+\^B rx g:3L5J]v<(vz*JnFٺ#]9^MDIL98#| cVeIoVjbX"LHpڮsDU;#g&Z%'"cNB"7Bb5979-O1%;X>k=l[1S 1iEIgr:#.VB}WCX`ZdHXpz'Dv8 sWNL=oٽWaXT웛W:Sy7|jll6,rJ$EmB/۠  ˶*vΪ`1h]K3 KS)vj}979-O1%;X>kScssnrZqNcjiJsgp]b5U KfΔp‘-LGVܺB'KzkPEU PpyE*\ohESsڜF8>kScssnrZqNcKS)vj}979-O1%;X>k8&qvZ5{u,FxACY90 %UQvѫcˮz^%;X>kSg%;Yj=j}9?79-O1%;X>k>JiiAHHݒ_vWKgU~,JV3b;KBITNYroxΦ 8IM|EEزbɻhZw=.YGj*&(P5Wzb/#u;5b7P܁ n7 kw|n[/#u 1y.(މD^F5um]#9=H{Zw4ndAe;DUe%u>͜"vNokFŧ!q9|Qj7w`ֵ+&b9nVRbG7rw^F?7 kw|n[/#u 1yn@Crw^F5b7Q1=ֈ"MDDvqCU7jXE_BUX* 0ImU78\uQ c" |uDEZ vUn쐗]mk)mɾ|gw=u9mxl?iɺe+,nYg}=t ;9VYihN{Fws`֍Vh+EdE{U=ȩ+ŸJZ?<ÄU:#8 kڋ'8ꬽ+b&&}6ElXKrH aOYcmrXX`er^acVa:WGDU&0;,T)9?w@ӞѺe+,nYg}=t ;9VYii5Km95MvƓfzM:4DMWޞ/2jkL%#`K-fziif;Gz[T :$FZePrb˱+UȋvoܤKVU9=?yOQ퉳46B?vB0 7ljH*/FS^I\:0u1]nصȉky2^K.VPṨ'FrmG9zCEju/W ("۽?#QtJ.LY"NE6ѯzn}p5]a.U;I 3r-[Df{G}X?=Gx'ZT~ZW9UUwWٶ9lYV[scw╷X['Q'lu5>V>0Q~zՏ#|>|acG}X?=GƿuKMESV ŤwA8QZd+ gg 9ߩ)o`VQ|JIvwcdˋ$uW/N s,/)?J[UYA}iJ~3P_kpO~zՏ#|>|aļ3|z9T*'[fq HV/VVg*-߲7B]ed*1 |*uůՏf~u8V>0Q~zՏ#|>|acG}X?=OWTY.S\r着ުgYLq 8PD{%km˪( }n^G1YBV[{+ab\<<V>0Q~zՏ#|>|acG}X?=G>V>0Sҟ) aLNFkC;{UQ/mV:RBLg \+1_EB?_^~zՏ#|>|acG}X?=G>V>0S=.Y>$1;>ƌNU>py#YQݻT{7nUۻGvQݻT{7nUۻOEd[+yJ.f$zcѱ|Q@/HOO?uFʣQwrTnܪ=w*uFʣQwrTnܪ~,U{TW+T{>%p$+R7$0ڮ ٱdf:O~zՏ#|=|a5Ziy4W=TO{-[xfyU-ǿRS ؾb#SVJ.I%H~U/s_dүzn}p5]a.U;I cVeIoVjb~q]URp#+V^\BVKG$>n$~?q{jq::2Rdձ[=Yc'1<T7BsSSA\8=58 eTLGVܺB'KzkPXT[}Daԃ3 |MN*2g=giqؾGP)MY΢pÃtb%2*u ;e xTmm U7BӯiTmq*% $*gխcU/U%8Xv/S6uu[#e'Yc{5{rq) p!j][n flUzx7us\!uu=o"wrV7&;rbE~½!*d6EGli{Oo T%M""ڱ2SS3b\7xLTYc'1<T7BsSSA\8=58 eTLGVܺB&ZEU*&#Q!t l-"ŕ\qdENG%nMk:kp 3Uމ2j$E_ 1 @V)Q2?V-ʗ5._Wd@*G&˜,Sjh>>2a9٧k1X6 {YEbbޏ2~!>-evdn$V>R] h+yƧ"nMSh-VTk'VCz^qBX/saSE?lB$V+Z3+Iniup 4*ғݍ˱] srޫ`#Rmɇ7R &5R8@WBWJAIXj}c&":$GsU=@r/aLjiҎdع[N˜H} 2/)b9nFT ^i 5@XpX1ɾ {NVνͅೃcv=7I 5>'կzϲV*ʉ%[SFBȉz+OMn|kߝ/McqkQ)f:ą Q wJ>ٽ2VU[5VnR j6?3f]59lY%f, u~%=nb8HdюKsS;.Ҿu5ΗΦ7:_:wKSXn|kߝ/Mcqn7~tu5Mܗ-7U≩&)h%> c/hxRЛ{ݼu1a)LB}[젲{9 .S/[y gU j,rț],)ZSSNt{Qɲ~LJƦn|kߝ/Mcqn7~tu5ΗΦ7:_:wKSXn|kߝ/MgbrT5+KSY7:_:wKSYm,k/"NoG*B6](k*fU^"CE|ʢoEMg6wKSXn|kߝ/Mcqn7~tu5ΗΦ7:_:σXAšg?b6%%"zl},(uUM$?O?IAh,FfDDo cl&:lUxͥÄ֯B^ҬВ+2HOIT:5^6I[J'/lYr'eb#.r_^ c*4 =oUJsZ$ZFbzk@ ”r횧ͼԳ_1XNr^}MΗΦ7:_:wKSXn|kߝ/Mcqg19D ]aU{ tJ>}V)`Kq~+#MQ5U5,I(ǥʇ;倏UKK&H30 tKг +FdoTK/BYl}%XL>*^b}\n|kߝ/Mcqn7~tu5ΗΦ7:_:wKSXn|kߝ/Mcqn7~tu5ΗΦ7:_:wKSXn|kߝ/Mcqn7~tu5ΗΦ7:_:w\N*&qn7~tu5ΗΦ7:_:wKSXn|kߝ/Mcqn7~tu5ΗΦ7:_:wKSXn|kߝ/Mcqn7~tu5ΗΦ7:_:wKSXn|k<Oqn7~tu5ΗΦ7:_:wKSXn|kߝ/Mcqn7~tu5ΗΦ7:_:ܝu5ZA=tWބ漏`eD Err/v&mJN<8vr*ܛ֧xx aÆ!mIiXHjcȄcʫ§ٜ֯NWt룭6YKpD<uyf3Q 욻+w={6m7z5+9sMZc-]|)m172Έ\9lY%f, j>HCo U<qѕ#HDEGxƑgj*g=v{6m77Q۶o|F&*uI+kK7wrؿI-}Y'1<`τ[v]sZMmh{†%BLKŚ#UWu4v7ޭ%-i Vܵ7vųJCjݱr):V/499lEcwWQ#lwC߹M׮D#rާ,7 xUzi%ˆUD9nٷlxGnټfݳyuͻf=v{6m75;yew|4jQ Ct%Ej&1-{;+g~pr :CuRsnMqG%nMk:kpyح:ihsM[.E'U** &*ܦLhm77Q۶oU'bdluZqċ$]Rr%ʷDG\ig9UW)ָ-꧁ׯzn}p5]a.U;I cVeIoVjb|vq=B B:_:!g|>#f=DaՔOKYc'1<cp]_XR~fmSyi1X ԣEATOW9 aҊ=dR7׹#dUU+5߸ަ*6(||dÛfAZ)t Яzn}p5]a.U;I cVeIoVjb^\Yj_"hBMȺJ.. h+aƧ} #|?|\<YVQhG~ ;y1 xݤX-`LWć ̀UE*v<1jiΦ75xt4Unqm?Fn]f*^!bU¨s&d"*7֪b[{,8OTE{Θ`e@D1cbjlr.Nc‚B*ZN2,d^_Uz"S3f"-{yO7X51kKС "pv<ȵ.f"*oݾi- nq|odB;倏UKK&H30 tKdcS TkZ*vkZZIv*]R e xZCӯzn}p5]a.U;I ,VJbB"#Uț[,#gصRU{Qױ>;mwm78쳸'neV[)e5"lWcs\-!0ٷzCrx7`SPTLUHt@cz5OAՒS4.B:_:!g|>#f=DaՔOK+]|c(jv*vMGƽTuj@{޲Nj: l&%[}լօ-[ityzs:&$Я ;bUU!vgZ)hQzD}|G'Mg؅{j^D"k1ZZSᒑ!yHnkUWmFYjZDEY~#r&_8c5|G'Mc>q<"k9XO1Ț}|yD>#r&^ьW{5MF,Yc|}9®Ƞ50lKq@,W 74 )`BB_+lWhE6;QZm0SY_8c5|G'MgJCKDL"xYҵRgT>4i!\3>}*t"/]5K>q<"k9Y kg\<"k6H!@ ^U&t(Ž+cMEH{]x8Najeرsz%D^OK;LL*߳z6uu[#e'Yc{5pTqn|U^ %^%DL*xY_8c5KLsSYȖ^ꎟƟqӉl>'1Mg}|yDxkR&9+<:*vX>$7BrȨTAD'Ŗ1Z8͹O=I89^j^>͜*;z{9XO1Ț}|yDd[[H娈DȈy)4,JT/ =ЍٺuOVbl ,G8(?e=|j cz2FJ4e^ Sf9XO1Ț}|yD>#r&՚"͜j*;S v XRع<,߲tYHF [7872?!e>o O*]F 5RDC^ǰz{|IO1Ț}|yD+<ƩjX$nJ$/)Ypj"ޚKڷd+ ^uLHѯCOm'SēJh9Na RGI" .=gzޒ|zs6mb"UWj:AD#2xͿR6/JvMFh9NmwTZTYI4Tu?7zIXQOzޒ|>nnw+u$[|'c=FI>V9}Kz>*oҧôjv[DŚ 5UUy.N*;2իt%7*]:{AE#llHGp^%g(hڣ]DՁ/&ܗ-{7zIXQOzޒ||JU,⏐v 8H{[zxU+#lkiZOwxĵָR {:#Q}=TFA Bլmz_~ɖn:zޒ|ré& Y4_5YXPR]Cn݇uD^4ɹEصQ|=uŸ :v)wCUTkoD"![gXU>Yf_R앚>gX{RP4&vjre^x3ՊF֑^ۚzIO}Թ!*#J_7zIXQOzޒ|>nnw+u$[|'g-Ez\|uW k;4eUj5Qo*l(s_ ]Z$k={ zaTx5BVmȯT:\%#=іX }/bKE,EXH b]z'V{?7zIXQOzޒ|}Z6 ,9H.OEb*}w> JgFnB8QEF*Y_;}&6uS#B2Zrs53 N5/H :`c@Y\ R}ȄTUMY5Ou_7zIXQOzޒ|h !dlթKA~UbJuai0b&6GNc?ۋoG_ Iᤡ9 `mjJz:Oq*UNϧ!{WooOw=FI>V7zIYT8pɣQUU[A~1zf2:^F[w*_"HK%[ityzs:&$үU:%m~ K$"W}.6wA+SnT~rSMZajbrʆ #L_3{eU>0::2Rdձ[=Y-3 h*G˹[>" /-yj*܈:Jܪ6Z;F+Orۥi`Ut?ʣnTmҴ0w*'U5{li B"-UN_ (b^E]|DJ"&$J:$e70,%L3ڋr"ouȆۥi`Ut?ʣnTȴٶ+H{ X+E|*ULV6uS#B2Zrs59!F|#*nەn#6"xT >Ә% UrմBŖY4 ׼9vӯzn}p5]a.U;I;aV3JǨm9&3|+]|cH>}S;8IL!Mp|x6uu[#e'Yc{5Т?γYϣُQ`ue'Rb^G0lHQO+1~zWΪdsYƒ&_#+[n]WyF1sdxYd61@- nq|odB wVҿ] ڷd+ ^uLHԯzn}p5]a.U;I;aV3JǨm9&3|(Q?b^ jZñlFyH3ЄW7wN0gXU>Yf_R앚>gX} #|?|\<YVQvN ŧO?nd+?#kDtBRʇ,12\κI[Yg~nrp/.l 7&#%, WS/lc2v1B7 [Jt,[jEsK-{әi1 կzn}p5]a.U;I;aV3JǨm9&3|ڳ|+&lYYTs,5j]T}NVH J5!?bEUU^xǀ Lt!'8{14ÍS9lY%f, FߟγY;6 KOJ3IR75/9'5njϸQ /_bm :Ue% xnUUz犯jQ/U,C )ER!#U792UTX*zB>H? a8Xvc:Q Y-}ꈫ{/`͑frB1^lKޫw\+q+'"Hȝ1p#7mv"Ct'+WnWbV,]ak^λI֯zn}p5]a.U;I;aV3JǨm9&3|=6n>+ƫmJ&4͜ &=TW'5`گW>S'Kq:Q$e]hJ*%y_*CjTOW'~Pڿi}S;8IL!Mp|xSUje/]&Z^w5TiQ& C6.wxʷ3mKO6cs6ԻTn73mKO6aqfڒ~*yk4`\lR"'*zMd+\,JO}Vlk{RRQ̓nDC>`)^-RzCAٵ*"Y~TX/"6]UDU7^ލs{u<L>8Ptz$XʮOxQee35M@dGf˂<,vڝDbQvV6ĩYU\c{t};qΐs䇉yߚ_8lQUVCc]/*BW. ]r)%)o"u׮U[z1g_ u2:@2ZT)j4|[,^ZaR/l\F[j]ykڧvj]ykڧvNZ&U -!r#!Sub%@ulGUE_Ym"ͻYj]yk>=1Өx.hKv5+t)*u lo^dz*R0K.l 7&#3 Ri 2W9r\ɫ2K<w5Rndڧvj]ykڧvu)zYiXkNF2TW.[}W7۾5F,]-rjUQ~Z: iyi_׮m[ityzs:&$ׯzn}p5]a.U;I;aV3JǨm9&3|ٜmIJCwBW"9SBV lB ʲjeקEWwOt 4o 86Mb~)rQxtZeʹܩ~"Ol5RHET/*Rsr͍"#{}ITHqI^9!wSc81V?O?Xq?+=>ϵY.E4OQcK$Dw]i9{:"d̰z t'6r{cTWDF*7|vq=B it}p5r*e 8hx t9w5ܾ6 8H~cmq?F8Y ;7rҌ[!c>AuB"|z\T|d@$wL)HtKԲ)?J[UYAT:^KBz"\%pG*eg (܋8-VdWlFj/K%le[)XӑV{yLHX@nkG0\H\[u['ezZX4 9zYUj"^S;948饗V7Ml?moMFZqΔjEz&+OETa7~[7I`-fziwFs-BӐLݒ*e +9(XEn_6Y3Ѭm46YCk<_1J3y/k!8jml}CA*^z\*+%,Ѵ.,E'_!QsOEG*ȪkaEi.[j*[2Jj$w{ܪRp]ʒi-3d(K8hHH! \$ a¤5}Ȟ3;h-'b Ʊ IXmAx Ai1eFy5bދwKoʇ Q?[iFwzUU[wTYZdsY2N#:w÷ M6"NFݺ}7ߑy%q.lnzfў)ʺTlniz!c)jzD׵43lN`˜<,߲tYHF [ƪ-߲/4T3g*W Q8#VjZa.|W'|xo{W§^-o9V봘ѯzn}p5]a.U;I;aV3JǨm9&3|D%gj*"'*] znb+w:`jTγIg~cfSAXiƺNABNpO14ÍSABNpc h+Ƨs,/)?J[UY@b^G0lHl ,G8(?e=|j eT}w앮-9XS6GNc?ۋoG_ X7um+бm}A./Ng]Ā?үzn}p5]a.U;I;aV3JǨm9&3|D~/g G 0'N}%Y_Xٔ@f=ZF񮓫|vq=B  Lt!'8{14ÍSO2J'ٮLժd+TأQwv<@-pKZygCUF}c | mjwe6 ߊF%k5/au0,pJۗUQ@6uS#B2Zrs5.l 7&#%/㌏8"@nWbV,]ak^λIӯzn}p5]a.U;I;aV3JǨm9&3|D~/g G 0'N}%Y_Xٔ@f=ZF񮓫;yK# \KQ<Z|RЦQQݾb ABNpc h+Ƨb5Y]jBNp-V>Z] h+mƧ8nkQUUQn4}J=$K?zxQn8=>u|dŹ{Եbkf#ZCdέeavQzl;)蕪E/^(YW*S{%h.R`YgU29,A/앭.d*')6>z"Cz*^w)nQd!r:G%zȜMWs7*wN{_qO45nn:6./T[Pk+w-}A./Ng]Ā?կzn}p5]a.U;I;aV3JǨm9&3|D~/g G 0'N}%Y_Xٔ@f=ZF񮓫xsK`"$>n$~?q{jq)cT8DjIxrڳ {*fh\wT [B7I>E}̮՗**Ƞb5 -aꅩi-eBK?%5^8-XI5T^[mGLvQ9]n~Wk3mGLvQ9]n~Wk3mGLvQ9]n~Wk3mGLvQ9]Ӷ͍ʍ}z佈ּ]6LEi=my+ZF3KuX4]:uQ9]n~Wk3mGLvQ9]n~Wk3ϧ!zMY >k6+\F=z+SC~RSlܫr6V$JÄvQmà|:{In,>ʇ JICbܭTRj,|J%6`r_qլ)qV e Y/'"3Qzo86uS#B2Zrs5.l 7&#%/㌏8"@;UQ삑TF)4;U\% kDoE\f;3mGLvQ9]in$~?q{jq7h_'X9VY㴟gXU>Yf_R앚>gXZ>3d&1=4̺*2#+rV0g]`'I`qanNckbliʻI:!g |dmu_9XS6GNc?ۋoG_ X7um+бm}A./Ng]Ā?ׯzn}p5]a.U;I;aV3JǨm9&3|D~/g G 0'N}%Y_Xٔ@f=ZF񮓫xsK`";t):z#t!&8wRUeE:~{jq7h_'X9VY㴟gXU>Yf_R앚>gXZ>3d&1n [KZK [| Ӵjo:&:l;)bHwD,B=JTOdW ( ˜<,߲tYHF [7872?!i_׮m[ityzs:&$Яzn}p5]a.U;I;aV3JǨm9&3|D~/g G 0'N}%Y_Xٔ@f=ZF񮓫xsK`"Wp!Т̱U7wmXIR^kQ:uDǥ+4[<2XNP5te})3vlG,JO}Vlk!HYT6Ƙ\] 'i n#C}Mr*~=ޭ>.tXM`V49sZ$ 7~JtDF*Qʛ}HDIUʫU8@`S&}틑VjSR9]ཫNz=ztEOI`d,V[ xU;S6nSfc ݕ4H%eG"=W}|&1LŁ(ط^^Ɲ=(i_׮m[ityzs:&$ѯzn}p5]a.U;I;S{ڊԽ*N5jjIHӋ}!8'G~ ;y1 xݤX٫R[:%u5Macդo:,W 74 )`%YdKܽs|_r \_r!Z~Ϋ[MIEmtbz IS [ j>;G';N'5Z*\x U"~;GcvSɲS[ jW\s]7* 2r`VX{̄_uIqT3eHkj] :#f$Nʾ9lY%f, KsFȣܱGr(,n܊=w"-T|&jڅJ:I&%R \r\qgTSU_KB'`)zMPȐDO[qe# 7sT,n܊=w"rȦCV]7[aґcEz"5Zw^5V+HB{^dQ*ZQd&_r,(σ~nU #ѪR^;GcvQXݣ{7hE;GcvQXݣ{7hE<#3nl'6}D h63ꉲV9Ep-*nb:z"# ɾ pLb%g!kb&U[~%!S fyԔX[U0s$X"ި=܊=w"rȣܱGr)s 9^sao6*p,t?=w"rȣܱGr)jOk\9:>R,hTDFWnC3 U!Ԅ'nQȨʇ^-o9V봘үzn}p5]a.U;Iܬ쮂8t`SlXop'Nc2iCػdT[owOXQKY,lǨ0:v`fIl4{6e4Vk^/|#6_Hmgƪ8[TRz0UFVh2tDE\I[,˭cB ./;"޲Ii^˻9zTVc]Vn_m +46aKEr"CT]YnZb'r*+ e9P(*. R[25.ET쩱wy'5{.$QEeG{ގXJ:`CsxET0eRXbzr5"S=%[0¢+/B*5ȝdC gXU>Yf_R앚>gX-4 J79zŊMb~+ vQ˼wm0NkuE컼Chws[mNkukCJWyF‚j܏DEvJ2VZlN %Kg©?"CG-GUZn$+K`NEDtfETM}jn mhd9d8$ETj5U{.$P/eE컼Chws[mNku ]In^˻96wy'5{.$Q* V{gs>鑣aTsڋw.y>JڍB$Hk0]RpuEHRxO7 [Jt,[jEsK-{әi1 ӯzn}p5]a.U;Iԛ@jJ;EzzxN/͖}RlFB|¾zǪGGDH^ bcn(MW=ڿq_>K_jzT'Cd᣷r'YgD&DWv\szgXU>Yf_R앚>gXޣtfņ*-u:e]VPצ5b<[jpo=uk>kbDXpoUyLMŚ9\-'!)r_|%Gy=`wT: j~rزV-u,:gPG9;]zEk,o=u ڿ|Zs RR ^͒]~=eiFc%목o.]YU/Q}%wf6y)7]A/XWi:Nfk"9p)w[jpo=u ڿ7[jpo=uQWmk!_Z}v^|6{yt;\c:,+*J bƦ[BQ߰k4ʰX,m%}#r"o=u ڿ7[jpo=u ڿ7[jpo=ȦZ !.P%쎅Z&]l\h[^-o9V봘ԯzn}p5]a.U;IAbR2NV~ H`DDeFz@%"lkTIԀWruK=k2 ǫH5uxX@nit/$R6 Lt!'8{14ÍS9lY%f, N/v .>q%?Hzh+[ruLtrQZ:-U j 7 [Jt,[jEsK-{әi1 կ $1 kd+©+XؔʵQQb;}lZEEKzh+[ruLtstRZ^K*u`4;9XbM=\o&x7X𘪝7JT]ʒi,Ѭlh 3 #xIy3',^N*5\v-+jm5E1VDCԾ ֍DVu~.քLnCkqDnD=yWĢ5j!B=Y5:qGPђНCeX5{Er/^=ݮօLm wG`i蘉gRYv_&asUMܻ[ `U lǜr&%_e|?ƽk4{Z%;X>k9b޵HFk$XN֗%wo_i MgqWXPpڴX~DDW-|#WQ kqDnD] #r h\Q eZФς*lOQh`-AlXXW**uAfl' xC wVҿ] ڷd+ ^uLHЯBծD[0:I+$ĈMsa RZ2H‹xR{,=cܤyaԞ#X)XzǼ5'H==G IR$ē#UU*'XK7}仃yI);g8o k71-up|U+D֊EDUsBhQ9 $Do"!퉳46B?vB5Z,H>j* ᣆ%n~Yj"+UxT֫ h\uٳjeQPe`B{=En\f @T[8zxjOr凬{R{,=gӁHUz υRQ7ծoR*qaW%Jlgڻ\fYŤ&^T}`մBŶY4 ׼9vѯܬU?'Ice*Tlc5H+"5 {Ke)2I>O86gFۛL7sifUnm3ʣmͦqTm3*q0ȉwoOL YQRn^M_37qW*OXWruK=k2 ǫH5ux}J>ގ*vڴ6uj6^2aoilK*[nm3ʦ]-W-HRQ] SbTE4M,yز1 ܻ/Y ]j8g "'=6oSp|ʧ̜–gQԬOTהŪֺzuRe`cL_ plFꍕYEDsWHl0-ղm\֣M/86gFۛL7sifUnm3ʣmͦqTm3*6oS[c|ʦ[j*OODUSYDW9oU<.jZb+r/Q<:zHRcQ\{m3*6oQ8c5CXs4G5zשi Rj#Wz.5^%}ʋ-AX-egRp%q促{A{ƋhipZr"lyWSt{nZou^r+MQeiy7L79F镦U)ciJV_Soc9Ԥە[ UP,i%᭓nOd5[;e5^,Aea˰x+Ϲb6| r\?Տ#|>|aĿSu9T  rŁ% :*Eз(U*0ǹW7eO 6oQ8|K KFa8MM/LjJDXqSnWbV,]ak^λIүzn}p5]a.U;Iܩ-fx:̦07t^bey^,pJۗUQ@X@nit/$R6zh+[ruLtYLq 8PD{%km˪( }n^G1Y,Zn{c'|I(. wVҿ] ڷd+ ^uLHӯzn}p5]a.U;IU库_4QCPVg0S eRD[[#DXM"nɡ5icgWpl++EZ#BT'%;{=6Մ甦EU +bOM[ 51=b/DR4VKXZܘ{h*[ruLtYLq 8PD{%km˪( }n^G1Y[7872?!i_׮m[ityzs:&$ԯzn}p5]a.U;Iؓ?ȼmZܫ,*e.FbzuZ^+B;/RV^sяEUDU떢U D">$WxcTj';[Ž:"`*)`|5b7d\FNL9G$F@E^;e]p+M{d"wp$R] ,6Sev?X]չjfMb?c母fYrO28uN|fVr جr e}i!g v{%j˫ ( }n^G1Y[ts v4҅-[ityzs:&$կzn}p5]a.U;I{9- m%;7*z'NőhM&v\*T̷(m0nP'l`ܡNm?u0(MgmM֎zVM5r-$WRbKChr;g v D6?7(m0VZ$׹nCsKDok:MUFFXS] ȷoV=qTEQO+1~zWZ)rn%1^VEÞWK]z7~tu5ΗΦd' 5 Yɿ~} y&=`QwEXD(%ŻTMO*qa9FEGV/,hz𪪜@Zjtws7;Ulm[xa"/B^%9i؎OI[3n[X75i%?KTri6D1פ{vu@qնu[fMV'KzkP6ݗ?jm[NQ8loK> v D>U3޿ϹtV,z/65nKſk]}9Xվ AXZ3b@֯zn}p5]a.U;ImrNiQcUUDl;,꒢2b; DTjY'+u_ cnrY ;/;E^oh8#U[DřJfʶ-˳zN6w*()uvuOjh ƤZfܩvв0NVt, /nB9[mв0NVt,:\% Y۝Zŋ ..Ho"G [4i/a[Ģt }ޓrGտtC{tБ(z]r ŧO?nd+% vʤDEDT]ohzY͇KSlgVmFEj7+w>v=v{6=Yjo.rlU|6ύ'$I \ݛox>BשQbMs꫾&ܶ1\ԺnDKȫye\pl`N>5}Nɦ^ςrXۡe`6Y'+u_ dsᩌJLZb**^9w!_ ^-d3,V'^8Aŏ.ūTK:v5gkӴ:'aCۡe` .Di:c _ETNsSY@cdJKFlH r+vmʞ=Wh6MZ$I{k$ɉ#؍DmԪō7JGlPsYz"D!h,ՑsnE[m77Q۶o<Ԏ5[8b#:9o'FoSCMt4x|G=UUo0zh+[ruLtr|*MBz%UEaPʵ Z}̆7W{u; bt}ubP`ޮ_ 7JOzUO@O-ܗ _19"XEQhLsUȋwjn..JNyrTU҆ۡe`6Y'+uֱ٭J"ǃ0sU*]ؽo+'uګypY Ux1n.w#/G}+ Mb/"$uY+! cL V&eB9[mв0NVt,R /gv W]{R ÖYHв𕍽u:'YWVIbV,]ak^λIׯzn}p5]a.U;IV)~f͊9uwxkwxkwxk?r\*/Y>:4sܾ5U8eq_e'YaWxtX(J޷cp]_XR~fmSyi1n93r=*<@|[.:c)sE@.He T0H2ތF/s'=Ǿs'=^4i#6J%/㌏8"@kQxQ\OPX7um+бm}A./Ng]Ā?Яzn}p5]a.U;I cVeIoVjb (ٚ$%GrlԎ5icgWpzh+[ruLt>tuB.}Fz,(7i: Ū~:Rt.m/i,)n?E3NV婼봘':Xج"XS6GNc?ۋoG_ X7um+бm}A./Ng]Ā?ѯجih45n*Y« th!Zw|:ȈrQ87P9lY%f, ^/|#6_Hm ŧO?nd+ `*ZLDTDm>2Uprt4gZE!"}'5aW*'Т?γYϣُQ`ue'R1x|?/gLbzh+[ruLtkUʈ*YŞE0b6HW燎 ePX pEE(.l 7&#$!SbY""DU[6LuDѰĿy >`}`մBŶY4 ׼9vүhR=|+\uxOstN3r+VvD\' =t"o(oz\[`gXU>Yf_R앚>gX QlR4|IܐY.< j6R!  .>1eFY\`UMe. |Y %Zӵ?BKi[8uQ/Mb4hϾ+&UUNSά:Z4IHH,K[k0jTj߹b@QKY,lǨ0:v`Ztx~_.m/i,)n?E3NV婼봘&\"_; V;a2rr] b\\,N;%bA׮UKz_&zk'HqqS/a9t>- inFѐzWCMիqD|g+ު*ުzT \b+r"%;-i2EE~U1 -[PozXվ AXZ3b@ӯTRpU\';W'4HMrlRߛUG3ڏ*ݙGQvdپ*9T)a!zNS*]Yad6a܈rSՎn$/[LlG,JO}VlkBd7tF"e/B= *-FrAb/ANNPQuX@nit/$R6,G#SVJTz> \TU߹.{%`D):6V+Z芝ԫJRk/T]0 b^특/5YF*8 \\=gcR!%`kzkvr frQTF.+z# $r%GN1+e,8-\DDabX:& ZM_pr frQT{9]nAUWj2 6HC8\DUb˪ Y0 €ި7{NT%]f}vr%3QKY,lǨ0:v`?YD%K]NfcuʨDOw(*Kr frP܂=ٜ7 vg+⍫2Q"9Uo񐳄5K%-Mث\;cfm }z3{9`=|4lRjC;5E?nbn7 vg+11A4jbW;NTS1RAF^Kۏ| Ӵjo:&:h9)f|FX']t g!R}^ݓy߶b5ܩ ʡepU(yP&:%4-ɊlIVsz"v*Z)Վ7ʮ{w&<fNUӱ .TB[O'kjqo9꫽w=XWjtld&|MDM!Xjn1nWbV,]ak^λIԯC^`ly-*ԙI-̀Oq ȰR nc}g}=Ŝ7_jqg#%Â.}F~VtGKG2#yYf_R앚>gX}%Y_Xٔ@f=ZF񮓫xsK`"HQ:݃5a;bQ{cn!sRjwm)CNM\W}{&jܨvJ𘬖aU7T;95D˲"_Vئ/87_jqg#*VHt]nj! ,N{ ^1]C`jfȭ_IlWΤNN9ndMx+ΨHE[sw[>~Q,vT{9㍎b[yΓ晵9},(>D3KF1U\|@QKY,lǨ0:v`fJ3b' -`чՍ1=v „} :,&+=ڣYcur;X}=Ŝj cvt R4F*.{x?KFm2HQ\EUTKNŭ~8Ocx;]SY]bVTc:cNDlZ+swDhR*lXP7b+RXGϟJに0DjnkC_֜!>f#޷5]p!մդ;AX ۖc1(j TK0`oD55j^3"%kתܜ7^grp\oUN5-cD:*hQ_ Kv;+Ӧ':#a ԜFlDEpFs)w ٱR҈!G~‘r6*n!֩?ne=UwXL+SP""^غMU,:M&/Kt{ur;X}=Ŝ~Gk>=5Cw%دynwHk oQܑb!o7<t1XW/ }`մBŶY4 ׼9vկzn}p5]a.U;I cVeIoVjbjTγIg~cfSAXiƺN  .>1eFմ/tWѬ+ YrqO} #|?|\<YVQ1eFմ/tWѬ+ YrqO} #|?|\<YVQ"jV7LwN0մդ;AX ۖc:!g |dmu_9qVYXPDqRPbDozXվ AXZ3b@ׯzn}p5]a.U;I i&Öc$0Y zw.wȪiZeWĈ9xUT2,fRtV]Zڝ9+f=S<wpj2oaWIհ)?aSG^VĊzBTD:kLZ7zʰ"B5j"޾;ux z~*vã":+UUUUxUOܣ$).^F"+_ K4Gt-*}\'^H!_"j*'bZ>3d&1ABNpc h+Ƨcp]_XR~fmSyi1 eTLGVܺB=N3U™|gnN0:YBHFE uf~˭hqea>}2.@nWbV,]ak^λIЯzn}p5]a.U;I=j>jq`{;V!Iwo6C*KcyR]ͿPXmTzosCXk{eq-I߿+ͻQ%ޱx.ߨ{IXmDYeb$9Z:b#nOܚQ \MjT7X`,'#Zz|%m*j}S;8IL!Mp|xn [KZK [| Ӵjo:&:l:UHRH=UUNR0#A+ Xy~iW;s'YjKJG~ 7=݆!H=pE9.q#sSXO1Ț}|yD>#r&_8c5|G'MgXu|U 6[^r^y: beDžX+SQ)sS~FإI#Y,7CTEQ;dV]c׺3=ܾY@P%o*KcyR]ͿPXmZ-7{|iCxޗWYoi,UjEsK-{әi1 ѯzn}p5]a.U;I܌쾭r:]ZM!e8hh; XqE۸VNsQjH:5%;!ncUuW=i}C=Y(TDE𯄆YDtG-%6#f!57^'d 6D]Y7ѵ"̸geō?tmH.,ojEqc~R,ˋ~ڑf\X߳N8"YD?tšB -/d>,nzT/NA']׽ aXd< 6mx6!Y3 +"`U~XJj|n 6fO-eō?tmH.,ojEqc~> jޛ+=MjYuU6PX/k!znK)˄u]uxμyX}39Ku^})fj5nURV `f0J5'R,ˋ~ڑf\X߳O&fLT_{~ W,VI@){r7W;֜'G=kbo^hbkt~_1 gg 9ߩ)o`wiIaKq/v-M]AlJѵA>"op3V(41幫C$.+9rfV*^xWgrfkzÀV7zIXQOԩ8%dγJA}8>䀉Ȱڼ'^- d2^s3 EcRYasN[3$HoTkQw:ȈtqU\3{: iܗ GUIVbČr58<*iY7ѵ"̸g̜O{ZߺC0+)gGǀ~KU/O;DH]S]Xվ AXZ3b@үzn}p5]a.U;I*HǕz)ݚ^j`{|3MԛH컞u&;.I˹7Rm#zԛH컞u&;.I˹7Rm#zԛH컞u&{gsƩeKXm_JuBa]-tG#%4XώsUWqd[:k6_o;7RVfJt{u&;.I˹7Rm#zԛH컞u&;.I˹7Rm#z&WsV2ѭI%:*jWtJ&XaY ކlx'ztjܨo;>Yڲqszש7ţ-ߖI˹7Rm#zԛH컞\h5K-Nڎ5͟~z%SeG~ Vc\UjÆG\C8KcuB:RQ6ګr5'Mv]QisnOlz޽ ,xk\-Sd.5^-z|&/O?IA|vq=B zh+[ruLt^(H97JRZR3|4aZB+H=ʦUW-~{wp|BӘj=Иdž>GV_rt(mW""*&vvrJܪ6Z;F+Orۥi`Ut?ʣnTmҴ0w*ҩjȔDE*Ftczrf$E^c onJ(ܾ-7H[lY̴$s Q|BuqƃhҔ6Q>_`wRm#z%ҧebBkV׮t.ZubMNUTEU>k$:fFŽpx΅ap 6Yn쩧dWfzިɿ#hɲ*1[dZwa:elv^%YΗJ׹ލr'V|yXfqć |$>n$~?q{jqWy 8S [Im 3SV,]|i OR1ⳁ[{wps҅G =_ 8dONW(TW_T[Ρx7um+бe}A./Ng]Ā7 [Jt,[jEsK-{әi1 կzn}p5]a.U;I%K-;EpJ@Tr+ֿ^` dv{7FX0)kն%ssu(yx5SƗ nZғ,)wC@Yb@'}S;8IL!Mp|xIUe5H1StVIdb]~_;G7z,9NoJZ[88NOG1$G+-ꪧ9^+RjxP Uvb׹vAjcu'eK!۽Q@Y\$*B[GGӳLP}`մBŶY4 ׼9v֯zn}p5]a.U;IQd-!KB|WYvPx3Z5`ѠQQyӨmG+wPڏiVNޝCj=[:{Ozu nQ?6ӨmG+wPڏiVNޝCj=[:{OzuI-nܫjvZ#6d:xU$QAktm*;]lhJ _'%,VN^WkMA5}%U]w,j9: F)-foXD^xH$+i'Vkd(rSrܟ*uhc/r_{n:ZIVIgdOM標ehsanZ_ͮki~6孥|knZ_ͮki~6孥|knZ_ͮki~6孥|k%W\go7CY)u-4ٽz-Q}XØ.Ɇܷ>M_AKZc4+)(j*ܛȉOV|6p-ڞq%ڪ5yw޷YZ\ԣѶKr*6[m9n]G{Ozu nQ?y7[Pzܔ[WQݜmWjX甂sȷoxWXƪLTt8rꍾ|jxU"vGluܧX3ЄW7wN0} .mdY:J ^d#8*"o~}Cpnmr^իG"e+STS];[ObcWQޝCj=[:{Ozu nQ?6ӨmG+wPڏiVN͸#o^Q#wZQޝCj=[:{OzuM%N2bj#X!^][7Ûj>9[DI tg"_jrS M؍ވ"{Ozu nQ?6ӨvXf[rd^w0Ħk 5n[wcl|c֫!Rj7#R4TroDT ғK;7*3yT7 [Jt,[jEsK-{әi1 ׯzn}p5]a.U;I)BS5\Z*+}NP=V|"#Uo6'C==GI<Ou䇨{R{$=Cdy!T#PYHz'C==GI<Ou䇨{R{$=Cdy!?R)l$=GKA;?+ }Zefj-b%>AV6$h KUDaHQH΋9oUSij5`^oY Z%RfYj߼3Iڡ VȻ-$ڤ# 9S~"it~ve<_|[Wևof\f߳{266̸ٗͿg em?xm.3omq~mˌ~of\f߳{266̸ٗͿgŘ^~0ɇeJRN+S֧E-} FBE}ʈ|!jp;4G5ʫrN#\T*IK/j9QK`!] t8MDEu_%^TXEGcgOu䇨{R{$=Cdy!?[OԤ]\:ZT%jcXU7c+J ~Y/ET]/en'XٸzoST7BsSSA\8=586E :ت.[0:1eiW5Q.ESZH"o=Tk-E4QI<Ou䇨{R{$=Cdy!T#PYHz'C==GI<Ou䇨{R{$=Cdy!T#QJEދ#QUT"Tkz1EUg1Ai謓_Z-ɼayDsf-  pX{1,Ŗ$.EF^}oOu䇨{R{$=Cdy!T#QT5월w]u۳'&k^waQ/o4iUX]_D:t7 [Jt,[jEsK-{әi1 ЯЕ'I>XDGcJ+YrqOvNޏj] F[}ubz_l]^Q.x/(hUOڗAW3b@ѯ:6x1ܷ%餙OYjgСDUHj>§^#MF-?|XYw!\|vq=B 8U8՚5UNU,gY|8nV[ V3LM=:]ǀ?ҁ*&KGHL>?Vj}ihZȪ"i׽b9\UoSK~5>iE}n뚷!G#ѴsǪ>%o' V9ZO>4¢5""PPt:"E3"-j]¿ NvU{'/,Y?ZiN{i*Pl=#ػ21VC;nU岫;ΔlۿDҫ;bYrݼ' *Y0X4~EVˢ\]w: RjZeUUUկ +dչMf6Zj,Na"I|;B +Yzr*)꿅9= _rhC(YJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű| t6Ҝ[?PWJql8Cm])Ű|3XҐZl8GZ_W%{B^ܻ%]-Rm Eوf-kQE.z endstream endobj 112 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/5513630024U0BS#=K# _LR@R!9K3@%+ -# endstream endobj 113 0 obj <> endobj 114 0 obj <> endobj 115 0 obj <>>>/Subtype/Form>>stream H\ID Dy@}kNЀo#xaZw%T/ZC0z|x1㟿_撀Yc{:Z/Ixzz'NO.}Lcgz 7~s!?36m8,Ո+3OAΤ,af|z(gy%ňٌ5& Jp%_&bWY `^٬4ܾ8&jI^Hg"Hb{DV|q[ED4u쉳K"$瓐ei8J;37xE.56C(f`pGw᛭Dɝka5B6^F\IRixy® WA*xFaչ)`+6 W.7gLeK-nOo]b}#Ba)O)9 UMN/,.|UNI!f#xk9H&o3BGAviL*]v{ E~}ߓL=b$بޱfB#&r/v,  ^k;G~0PG#jf7%`Am*b9&9"$i3DZޭ]!\`h'5|3(OmA8H Z:ޙ 14ұ"vARcVq MJ"V#  EFt Bb'_T 2ݙxի Toxj%]dxøj,frF@BV{Me!_:H5 KJèUj+3R* )Af2fbȳk}lBʉ!Lq "p* і/}Q(o9#d_uT=aϘz~2Nل0oZWB#bG=I w%Lܠ גpÈdKL `+i[ = c?Qq HpT#r1[*QH9Qau-82(Sv2xbZm>ͼl>fMZT')$,Jf_@!Q۟>MLqA9QVp8@*7*n2~*E Ӯ58S5aՔ PVoy8gFw&3rxxو1ܨr]PR)"2~Df lI %5KsTyp pQdQIFic8c#;=@XObu s[7 T~NI1CT]B-^n&;/O6d(D<{Rd, ndB.FLK³/#D(G/. f/}+S1ᚇ+dȼe{ ku6╣Y2"(Q]KI Ea.4Ɖy{%6c*9 SmYZV ,z9ʫɹ\nXpe8 յH% K*BLk857)=uf/y`3No24qI .5>JfJG%9j쵽؝bb!D" qv&)HC#v HunCTo䗥2u:mɐ|\#gE ېިpk +#s+ߞɒz72$#Z =l2C1$,ohWt*8DI-%zچՙ`!4gkU~DD0yιF<9'!cڨbN;e+r*xV¸ 8τ4!VACw5\S(:k9x{ū3r\A = mJMWglѲMWv곊qC|q3P UQ-Ig&TԧJ9& U-ُ)M:4vc1g8R86LJ Eq|tʺFhmIlC]FMpQu+~<蠕(wtCPL W&n%d?M\ Aws Oo9SI̢eP%ͼb9v+F$ Fʄ}vSң#vxLe?Yom35ԲÔh씵o@eQzL<R3BxJ6wAim_[+Z4H]Ep|5n-Nڡ5f*x9FF6V%#cdMA >z f^ ~KV^wْ?<.`PZwzim)ʻozAy\4!=!h>s` ^n) F^I^/-w2U/9o' W(!3A_ L-GG- yboT\X@Ę&umknamS@s5( 1~wRb?+RWul@$*#NƝt rwD֫Y1zƑ 홷Q ]z$|D+K8[قprx#@TT1_9筓# 4ۑ5j)3NGO:Iu%5&fpD]VֺTˬJ(Tyv1stc]PY/gNW  { FdT d݆ ٣:CGb@;Z)Xm>9.Gk0AhBut |sI+1$ٻ911{Dc~ ]&hQW6cTl3ʡǴ.4+d@Жcg\gtdMbr?95׎]Mb[Bbͺ]o/'FcXڏ ttQ7fZb=*$]j*0b`,FZ*h ZeA*t5t} *)d镌b5D+͙QBXC"Pe ʢICP1Lb|]i Ze3&5g3Uy[y@Ĺ\7X(-8F "4UGau(A;TaOopV5GJw's»[_fqP}sxZYWab+R{v/s78^C!k i^DL!1tjVq4ҝE^>^0Ώ?>~>Yȟh 9&??:PկTl>> endobj 117 0 obj <>/Subtype/Form>>stream H  endstream endobj 118 0 obj <>stream jking endstream endobj 119 0 obj <>stream jking endstream endobj 120 0 obj <>/Filter/FlateDecode/Height 572/Intent/RelativeColorimetric/Length 22144/Metadata 119 0 R/Name/X/Subtype/Image/Type/XObject/Width 842>>stream HiXTp]6AuDE>%F#TQ5&)F(hqb1nTP.@ТT@ WC%{3{9/{0W==B!B!B!B!B!B572616ԇ c ;;k S H[vpq=i旡;8t.%R֕+.fKjCdgiY5uwOOWl;q9Faa~n 'vߥ :RN&my,y=0/B7 ~Cfnwe֩N|tbltHEڼ5E-h`Uo^hw{7O h9"q9fEg9vב{Qͤ.27wwCFðO8UPKSٵbOGv/='@o.%>#^A1EO_qBWERy?M:GQLuCAuZբjj#j&e1%!sŢX'^^.ɦz8T2spv7xObn=\:Y3ϡ >J҆3zNA6<$γ/(/ BZTP6TQ~ńuY¤S<ѥWE2Jl|>[{ ?ʯIQ_;l?;\˦QL2Q|oHwNSVYp_bG T@Ar?b+({青ؐuZc@-qFm֑Fn6v:>-RokҾJH{~w=?s, @>J[z'tN7uD&}?cc,Ȭiuc难?T(T\_ܱ+؇Jp#zYN0tͤk&*p,'tRt͠j{•c`"0 ?뿦t5`:7R}^ **_AQ8t˻{ g_9/I%YJ}}7K-nz p۟bjv9.ZwԠl?௲rdk|f4[REr&h rBڇ>-ɞ\۴W25 A tDkRwQf l!i Q3@&.lր8UJ7|RVk@(;٥SA0 5 !ܠ!tVTj(]VVc$Y>X6 JCN xN 0sV5x䴪)> [XxHMjtx5T{8}/yjy bŦY UG:)|iUc6\y' |ZB>a͑0F*lPWm.=W$Y ٱf|??#ؐB+ݠj#B,OQ10k=Eiy՞Be@QEoqٮ1(4ې<" ZZw2l,: @6z[hI&-,<:(&fua"`Q_p9j3!Xa9>Q =SD^1֧C端Ogp6LAQpNƷvZYDt] ﹛jNMDm~tENl1ޑϷ5(4gtƝ$i=j5ކY)#Uux:o ՝b(+sߩ:ob!".s`>tV<WB=wL.A{!wOG3f'8 +0:[jEݜĥONpq|"#ʔK:\sO6:B&߂bzlpo($<#C(lOawe\=.Č7wΦZT~9 =*Nf"Q{1WA S]|t\l݃ƜNAO  tΈg*.t82vGۡX+Y l|>`xj$هo)v`xj g1҅Qxaypz4FW%A'uەyzXz28&wq瑲VAяX`M^ v})w7DJ7~ۓQ˜s@qMeKW! Q)&QбZp^c]=$2OW,Jt$̒<zHXєЙp=Mȓ'DX׫-Syw.H]x+БxA.+R3|=C:-@XIꕁ#dH^H!KHk…cza We}tX&H Sh@J5Wsu;$DIi~=5*0:,FwܠnouiǗ{ԻuGimo. YwK^('tzA 4WTբ^({"2nW-RJ!<^ ( ]?~ ($;BxEP@Z9J:!^ ( ptz3`KwT*it/lN_KvT^\ 0[Y7{#%=UR&V]푟}=WɶwrV`m΋D[4,BJ@{Ng[|Cdΐ)Pvk.i` iJ~)_M~ ;vGlMzwugw}85w}+2@hW9~,):U\,w~W$EmOHބ7rvטFNj W O&lߐ2Zpŭlto&]}?n 0-<>;($;镸ༀ.{ /{ iVwǺE f:WcKI7fsKd_x cm%yķïǯo:cJI٠%K3JcI78oat7b D~X|-S0:_Fc<3u->2kPYyց\|<>`~:kWl:չ(U}j:6X=G:uu%^*ŭ%`4W{q;^:mR_0ŭ5q{q+ߨ>`6V݋[q^J_V0V݋[f{q+yA}lRV83E`Q0[Wm8Y}ުT8΃ս-W0km8YS_u/nRX}f-Ǩ{q8Y˱^~>`r;\\q44S},N>`2P݋Dq^.V0s̚{q;U}j^*V_j8T݋[s߫>`Թ(;e\|oR0k:%/-WQy{ԱZ>`t:_w]LyձR}h:_ձO}4u,zT0iWE@I7Ա<>`K&Vݤ>`dF݊_ܭN%%&Sԩ>`2^JS cԩܪ`=EJM-ԩܢ>`:/O<_N%Ru(OLP2`mԡV:@ɪP%PF@+՝+Zud|ݥ`g۾\#<*u&'|뮥=lמ Xv:u2(U}1#tSWbRԵk'zB}1#i mb@GSI]FXP 2B[>Uۺzy#( (K򰝂:<@D H˴, *Cml m("exnC awo.{{o;sN]bBgƘTV4z1Ȇ3cLj z/CcLbz/؃Pk @ cc,K8tlA/"I.tpWz)BXPh:8Ƃ CBݫ1 z%rCGXPl:: FG=P,.cušB3aC]gu)zcߙ^DEXo JٖdUSt1 ڏNjgMtU{aΐ1Eg"o :D@])2Fcd5A,oz Tw#3-KTtR+$=^YZzTFg,jkg:Lfay%l}a2:o_Iբd~U=VΓYi3eeT=*YY[W~t̊ [_u=P{ Cʬ=[Y͍^\LBϼ6er0=5:Yf)%]2+x@g,d{ z޵8NYƭqR :^f)artУ1)t2Г 舙\lt}_ G@[蘙y<"sff7=nGʏoff=353 Ai3:=ݑx73Yę) Ev3g&țcp;3C t\A4 ':zf&R 3>3D<MELfiFYΟĞaƊ݂3*zB7gs?F)օƙF0c;zu"W)Wt!vEϪͪ@7+zP `-tνzHO6SL>|>=Fl -S2=24cL*zGhZ}ӣʎ4Mc:Lـnӣ41=z =gLvxzMc:=tӘUC|n!o?\RtӘCϥLG41=ڈK[nӡ/p:8McZLIA~.r2,=O ;Mn^@-[KYE^xztOԺ4)Z5]E;KE^rr<Ӌ13G}1qmK5 Ӈm^BsuNŝ֤LԶCgЩ4Z4Cy.~O!I .r@ҐRDQF&d6'V8P>mjm]+GҠ:(;Ď0fKӫuW3Mh:Oڴ&t换ʱKvĦa2!M 4Rɵ7o١go8IFQ7iaP R DNH׾zF-ubG59;H՟I ~TZy3tBxT[p|{^4fy޷ns|WWIpUTR93ńW% _;%\";9'N=}8 >FCFOh|vb}חOUh1FHx#]ԁ|Oi=6&?PlzɞЦcK;%THxFceA`$|Y$*+o_J)8'C/;<_tSPuJqI\^v}ު*/if+;A:y}aL,mTbޱ)pmMjBjpկ}я rwU6z|!\Vt[D:`LH$Bmo,&KgmbjV:*& \VpI87@|3I' w/Y49KsrwKrnI_)ĞvGL9OHUũauD#n*vi+j^E_iP*^'>1 ۚCFSp%Tw(?e}fcYeu@vYFeAATqфZ.Mj5ZkL1UԣUԜqדFӈ6&YPb>'9;k8c9i,4vyB݅/\ B#s>5A5f'I`dEfE5=zh֘Z~`c?^MZN8n7::c yr c2sН2S;™>c ÃPJp aEd$-Bu\с! s斦2} 3gX`VW 9NmdCS\eXjvbN$A|F #6`dÊL; YY:2{"8ːcvbNVix_WH *Y" x*2#V"[8N߇vUǘ^pzڂI..E;mF OХ4R7@5揑lY$kӑNC[W?)YYQBD5;3 "KXXxUzA!ܓP6MGޗpU#q:ZE(lzcb&tRg$cgh5RW` &U.?LG~-:wL|@  E"GO[G`^PbUhnb. "pԉj9Kf-mTn:$uZ9ze%K$Absz|5 5`KSs3sC#nU׌RE߇i@[]n๦#p&S4 ( G=o5\P/ o>KRg)Vp;Duoq<w75N 3}}yؠoa]SKhL@=̜ecܕyi@j731_GRe4e}# C u+MptI#y|-6^,$zoL""$$$",,LNP(BʫPR@T(JXz4 X8*/6YGhB! hϡH}lF-80:G Haâcbbbb"51 GqGbKM؀aW@gWpHHhhhBP(Rͻ9>OL3hIS̪hwW]-[w|iK-ffU%Ib(5,.&vk lΟ%66van6e`^Ag_hLllbx||BbR<@ˁQyE%e+UϪ[N [ّSzʬFtsCq)*U4{a9617A5] &OlH?V ܁MDFA"=]l_؅Ay295-3;7sꖬMwб3W?x_T]wQ\vcS\c;p (Mz]9wLW- P ihrEhcLh9W4dBiYɕSUUϬ]+ubGL+(_:ij͜îO/Z;{9W?wv]W~dS]Y2:߳ a?Wrd3i!?^Gg&'HѻU\ 2`MG(TP̈́3NG5w^%oxwUúcK!axe2rSndqˮMn>znm=ym^?4(+t MݴM7{C-l"(/  bNܣD+&ĨSD-wJSQScq&55}[^3W{ ,zw;Ve'F|5Jŗ snh ]BȾWSX6&D*AFиyӭ<= $444,<"2qe;z,]zݦ_zZCAOHN Sf/x{m\vkyt֕KVҙe}_AߜTO&&LwCӱ8bl2Hxk]ҭ1H 1Lq IIFL=o?䳽:U W7wa>!aѱ i9%c&Y};qу7/)-a[Ykۂ7&.H3U21Wp# u1G),S{7KiQZ#TOLLJNIIMMMKOO033sSNh{keǾoNt/ַa X,0LJ -_B9ywl0zDB;tҳrs3D8pa!O8cWQU6 tijeu d pPNNn~E%#KGUU©82eF{Gd_O}YuYp͝|>_ $REӟN+]>J)ҥ4uRvts:MPF{AGq86c \"/)FO2 e~r T]][?q\sˤӬsTo0eΞ>tϷ:pIbb,' ⃨E<5>a8xcƒDZ7(IdrXr,P<.E) m!YB0-'~&B- -TR Gkh?uʴYstvtY%&NoZԷO|kobYvpppp VtW8˄]\.A CRO-+xjL_׋],J:LBrlbrJ:8Rn~Aچf͙ݻt V)KSBRJjE%eU`P-S:zZ )vx$*GG \J  |'78G^q 2.A$yl+Sfy <{2X.-ܔ 1iٹPc@H:/]˶]{Oc GD ԌYye5MǏ  a)_KUfMF(BȖ %9#cr+NR !a8 9j6O"fU651O0vNi çYB.zr (c<3.q+b@s4$@K$2a2гA& JE,ggԲbMG!:2S\bJFfv^aIyU])-]í?0 ..央0y@U4_v|nn ոa<f_㊰b tNDؐH,{A]e{wzrxg)3KEmвck@m : x==ըgjü"A9x/'$ &)6K3Sl#8.lj&F;7}4f*SM }S0:#K.E(Ãaٱ-! H*C*B"|LG5~}|]\醠TZDmGBÍ).!܊Ai,G۩(v*GYN)m\c[@QWg;xC !!aAeCQI!12ٲ#ZM91)p&aaw۱\1g݌Mab9â 8`BBHz:$##B"2GDFcLr},0PZVdս:C,IH$ EB(dF4Jek)z) o+`E|VP0rm m W5^EHId 7b/晌 D"Ql|BRrL#\]9alcSӸ&NӉa^n.rD$<M8<A $Tqs6zݔRr=0ONcXc WRх!/h,BBD:B Y‘␈R337y_бKz?~EgD{{+1Ȉqrrbla*jL$!!d!!B0. @\}(UAAQЖB ֊j[QcVRuG;UQt/hN=G={$fL97X7V^p_ObWABn5 3Ӌz1o D Hb="0 ==.6.>!޾tYyuk?ۺmί>pڻ:$Yt*@ qoOXT1ڠu1( \1keQH!p*%3]d-à1BI|k;:(4":.1y(xty5kk>4Hyقy --_]S߰sGzdVZe+` $y4Lp"]nCa$TC0FquX2P '8v?^$Wh#=5a2sN51NJUU6n/wD~v(7+3k$`9x{qY^rǂljG N0e&Cn!\[45d`tHL}!?Y\4Q$ȕ`SG&Mɝ1'bUm=t'[/f''OIN̝]XRY?_v,L݌UY9D) 'r44d07O{1tZhD2~ HJPrgFpx'۝ߘȘTmst٧vSC>{KKk@ J9EK-/-!2$8#{;|?Es WBCBd1YlKKr\Te 0fT708YﲦL]|_9xD+m=zG/z~㹉~N*RrrvUk@몒yLf SuJd0: B n1B$K"k^* gH`V[*D8L.Od#)]<|A O7+dEe'[NtO:gӞwZ䦴[D"m$RQ!s43"@Bp°eBTYXhdJ$Rrݹyxz5ccKy1$03'Is%KvRo@PXTLBJFs ۲cc^j^Nw6ǒf `g@`a[)$S1:5R(^ΰ~3Y3Dq5ST[<L!\ݽ|#R2s ~S*ٴQ/%"1W )h ?~6{r̹EK*6mnعHSGm-+̎Qp4*&Ђ J2hj;=eȼ rLLOEe5Da\5[Q0#EA.KM؄Ԍ-()߰uﻛpϗa~. ;%8AG< ͂ D6v2;~cB#cSҵ9 BNx;V >7 -R>]20A&c(/Cetzqը0&{`FILN>e5wk:xx<^pzڸ g5gJ!f"T9ͱ; drB h>n*cA53nq> -VfX0B%waSL E7Tb/W:>08<:>E;yFڿ}ϳoe;ۚ\Y3>Yg.xFl3,KuBT;{)0BP:Re2LL* ,"2;!DʇUhJΐ>d["Әl.Oh-sI3tgx>tgkL򨓌B)J[Gٖ G[q-YT_d#_u ȬA_`kH.z[܁ǽ @ۃ+ePts#;X\<|#cg̃8s_=s2s38}pEJ<\+f͖JX$ZZƍIA6D㮑ZFQc,z@A-5M޷LM/>mnk_~s嬒lWQqt#z)A @|>([86Y,|yh  /V4pGX=w13p{D 8Pu!C 䈈O/4n|[w::o_?wlK%D4HEC_~^eWP"j +ԻF.w.]!ẹD" KPGA qA Ilɸ1A!x)l;#bS Jduӛ;8 gNIuX * E;T.VJ5¿7Er#Dh!t:dPgxLBQ:6 fIB"]Y%3]0^^'%I%oP{Ia\9#̽|3[T6_t: `|.0M) d22R\ю ^'pDz)]PzOIr[I G𙄓 a()5(JHN+_2jzuݢUF tZTs9(&ZD8 &K=8$$h +e=*d>KdoEO:7_&;83%HdrFkG1q)9*U{i]=ޚ8ՠFQ8OhWR>fkm޾<{FPC/9m#Ijp w > 1qTq)]|SXtXm4̿{ YaDT+kX,KXP(9"$+P>K7t }Ƿ.}>U>I+=\h=AMR>K#)}2"?|8GUe#O㓉bR9bt%fM]lwj9q͎! ݿu9IVK3)'GRLFP,䈥z%4N#`0M`g+)#`Zʺ:ٿ~O-a1.D4BE=l-'-# $jSҥQ>_`壘C¢\ OB8m'_jk?ݺfbz=@-᱈ i=BEy uC H*d~HrBo smf2iEAO J89#bҳ &Ϩ[6nXP_WU;V.2P /PRNchW"FPjFtz`%WYt`PI1!b MThF-(4<6>5hb9)Q#q m ZZӷ#-nҩ2eO&$|qXTk  MOgZ$Dr̢q#_ˆV$F@Q`Pp3<*3r7>^s8%*j+eb"gi`sB8? &fzZ.Y9I=ri$~p1 |4g!}g 2ހsdbR3J֯z羡%w?ߴ b35 )&q(Y[!!01L* l#ZI*Ȥ9"xY,6灸#_~a: [%bؒN$!"] տkv!$9?-,LvqX,C"!'r4j_y F1d6C`m{k$(iXRk0AaQܢ)l?s_{ӊ9$DDipy,jzS]IrP8 B:APgXxDTtL5vlQWrX2lA1cS2˪jz;}ҕk׮|Zm~(;)&,Ow"thy,A1n"!i: gx nL$Y0D@{p3"2:5619-#k\n~aqFg4h%) 6 0 Vf0%gO]rMc[ؿo-ͬMnj|T{M4H50p9',.9@B&8gQ##GbO`U%<߉ђ#LhX!ac e+_QbEi_lW)dRX~G5uql}Ia $; dE( jA;BZֵql:c8rV[N+QGX8ʙA n>܏&slJ΀)Α]X<|Ը)T/.pMz\g3D_WypWL{"H$TV҇T JP(Q#`jq+e}Pio3 rRR̖H;xS0Ցcx|gAQ [N4Mؤt #SG\Hdw*CƠt~AEhP)U`!:n4 eW8cɄ$a(#l1 ⊚3澵hM{R"0mRFg01P?bX#""`^K|F!yx{~COPFLҠ70 9>MAD Q7B;WXmvl3Y\>RCiOHI.(8uV}Бg.\w-^j5$6BXQaiԞPT"apN=O AE?>&D **JVkZ`0M&Sp1.G>jN]:ɤ7EDKsT5k[q:}ʭ{*u]> 1Ae];$ =V O!IID/|Ep^H0D2y@$K02nܬLzJZ10(884bE'$%;RV_+g4`s c8)ry W}Łg:oܾ'҉}k,JH;Z!q^Z z=ȑ $ D BrY bRBm8nSWL>14#G198$"5!xP5a&$B9,'ZV5k6uOvHlk2~O^XyaU$cNVJE|6L;煗 2VU#":>)ř;hLeL1k {6mlkǭ"u~BA! P$B2ZPqqfaťn췗o3z͋Le\%7 '*bs|a1$/G8gt R% eyK*F4mƜVo=wI;֌I4.bs8\>dX 5*695=z\m6nq[X,ݾ~ؾuMfK}DzR~7F8T%:BkDG?)5Cوں3派l'[?߽v?u\^uࢪ80ϢhTFc0YhC:ABIgw)(*8mݹw7wok{j+.,@)`}_r\bZo R2rW;i7嫯+7nw4ٝzC'(PId +I`hÙSP<98)xKFg}y $ 56$d`3٘ӛ[._{;zn}K!*1NF=qTDG̬L#.Ut.:D4TZ)3ـ%(g-k߼˯8v_;;;C;ۛjFFg9|X"WP!氰SN)qqp^DЩAćIO, :N2%U5'O9ݥִp֦q2J!H|0Qk Db ! yl&{rZ&(93ӕ[0zdٯ09bWGI1j4RGg77?ĵQMg'󼿽S endstream endobj 121 0 obj <>stream Adobed                j<J     q!1"AQaq2 #BR$3Cb Scr%&'()*456789:DEFGHIJTUVWXYZdefghijstuvwxyzx!1AQ"aq2r#3BCb $%&'()*456789:DEFGHIJRSTUVWXYZcdefghijstuvwxyz ?TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TTP@ *TP@ *TP@ *TP@ *TP@ zv#]?Z1//Dj;F!j]2 }iZ\i+)id$|#ů@TP@ *TP@ *T#iNǻ\זwW=?b\V9mm\uȍÉCQA;T&uev#n!ӷk()[a #YKd'u;'+RR|$۷_Ymwc7Siv8w< ;i-jR(KGQ $ S*>Мרi.;.{z=ƕTeaԥmR AϠ@ *TP@ *TP@ *TP@ *TP@ TP@ *TP@ *TP@ *TP@ *X7OtcVY;[푝) u},kV!J8OA@KH|RɛT}˳[.U*kr:Y[af%W )#(J䎔[,]ì{EXR>Ɠu.yމ?jN1vOʎOZ_^hձ~wk*.ɳ6D%N%Óp8y~A&HLGe-' wf-T T}_`%-HzrI{\cD͞dHOD`{kgZNc%I Rր>QЦρJ(ObuyIL?ݨOf:hN4* q}Z?sgJ(øڜsCY ( e9xF컲-n5f:[W /xŜCwvI֜da~H?%g 7ntxHIG7+@ l1Rp)E$:YYT'X_Tf?6KWy726l;{wnf9xQ_O؞ӳ$ܟ3UѨ(ᖈkS. mmRBKuIʲőK "߱y鵫N]}Sɑ_Z w}vd*ݕ$;sgwjI8qk)cm j }FRof,W d7%ێ:ˊm )QOր*TP@ '~M5Hߒtu< }<% ۪AJw))W+ioec3D@rr/Vlд ˄'%VChuCt )XJ֞gK*w>7/ZOm5o.m`%.hs->zKgS R iJQ0Kl<:ELA5iSKǢ~uFKf8PO>UsgzOSm~Qi-(DDJ>U6Myҙԝmv5zHtۅ䘞dFv=%W$믱U*:nW ʝNEZv#1&"}ˉJ%@A*B#@ *TP@ *TP@ *TP@ *TP@TP@ *TP@ *TP@ *TP@ogګ5jFOne[O\-Ema I ['r@RA=Jdƛnioe\支*XaP0ЂO)Hʑ]ϾA'$&y ̽S$ImePDx9PR;NVH"!t=LXnњ.)KYmҔ'rIzo#gq\z"eK>VEqgT{Zc;S(=l8hGF֙) |g#'\=Q90mic\koޔpN&Sި|\w5>г_ΒG_lR4 Ӷ!.-_}51 LIʼ>C=|&[e-[SQQ֛=U1QdcΥGI(s(k-$<%c EBdW7mGiNEQT6Z;ҽPHl(Dw'<۝7%Gvz:9s,i*{@o=Kw|[KsBvCkx+}wmBVB*U>'KH/֘f+ͧ]Lxω9wF{YP؀ Syrh!#:M-Ӵ/6HMzZ"5&IëÊ{ 8\ʑÈ*;#h*Tӳo:ϧ3oyae6%4VmB&杵큆em1">i%pC2և{*R×C)X&^hb5"imKsVѣkH m+0VR,#rT*8IPIs%}mۘmЀ=]Ŧ6^so`\)YJOG׫[ݞ<dž8;Y#ǻ:ʌөIu'\e+%Q |Vz{E_|0C򎳛?i6[U1ؾj"q1z<+]ҶYp#JD̆xTQM-\-OWj}FCx7{N&4wܶ o:Zwe2TTP@ *TPX"#zPNKˍlztǓ8ZB|)IQx"~O][wh _LI>:|» $鋰u("cBڛ~5n;)(_,U):l%,4ÊJsqP@ *TP@ *TTP@ *TP@ *TP@ *TP1/ipOfewU[w4)[C!5-r҃fvY3-#N{ǧ߾ N-˨Ef,rЗPUbRS s`ۣan8c@B`zTnDV@Bv\$4OsXOƃӮҒ'nx+O >qҷVWOO[:HejSQT{J_vHgUܕv"ۡb;I|EGmr (/[O^nzy.cw=7Jq V@~*47͞>-(e"tWAJ}BBƑgqM!=+(˹·4\K3ݣ*YsQJ=特zi?@s*LG]әy[BwA<rğs"/pUPk51}үO|i@YMdB eg)l|suD@:[my-;iBYd7ȥȯ˸KWN#ƍ uuAm )JQ2O%}6 _) ձ)p$␕ "; a{/EِHqUdcͲ=hKxz'y5 a!2UZROZGY&qnKMhŲ˘9J66*ۉHW%:WpB0 oJ]箎0.tu(*%?S](YrK/,'=R~rHaZO- GOpDiaA-qg<4|KfXڕ)VGC^8c[hm'&sbb\ҁA!AIR VmҕAIK4q( ?˳7D搰I~i~ۥ-Lm.!hZ\T`▥ η 'Q*TP@ *=Q]諆k*w_Vgڣ;PIQ :`q=x\Δ[h.ݍi[ki@zr+lXm-T2"'ۥjC(ZB;#UyJ$܋]J'T(}i w[ldk)IXm**PNJY,p"{KyK[JXzA (8T}I5\;&Xv RN ~3MrҊCm\xi!iWB}]G?Rl]'zy7ֵocFtM ̺\[ڷI\qs%N\Z] p%DJHhOɯFe?6 P8KD5nNMiM$I[Ҭ&|ewۏɋq;Lђmd4E 2쓊%,3Qn%CoRH5r=lKѠ!mm#miu<\Fdsbbu/:ʞ{B6 FˆC),aEKbl#҅OOB_ʈu,ߨg,GR։ r,y ,7ӝ(@$zfG]@ryxAm^dMrΐ 䎢ؖZ$N*#PR)3(p8kڝ㯋?҃Ѕdcꓟ}}J6or BW 'nRe22F._z=Kv8{p+<Ҥ3 ʣF\&(8:v93ݑPd&=.~PL-5J1\11~J?-y ٟ֯Lwa;RSG?E /y㪅ӁCR)YG:eŅj'L 5~l\=я+Ěqm.汸xb,)gr l?G򻀂`/bڦ&)l'7( J&&8sk Lg R;2)OO;.n»Yj5Fi-k&@Z$ RZc! =c; uܵ[ߔm*vCRIQDD4xl9rzVJu3Qr܆{ܶTeG K c˒E/o/C4ź!PQe**r[.y%(@'m# U#?.Ȍa̙61Hg;,M``|O{=W)a*AxnQۃ7AI)q|)=RjH5g-Qޥ닣zոڄ1"O_qUZvpH9PI=pzѭp&6;#K )YW{vdx:}"#>NWo|eù]R@zך;uhzMu^ձ 1,rc;ƜSjJp;8 J3I6ݛͨtutmg-J,uLHhVӽ`aB'bcW@ *'&G̕p'!G!LvTmVio!O%<}UžFv#n짱kcChbXlwTޖWvbF\LV;8ԗ|,LJ{ fmc{ٷ{TPvJ $hVU\ jw[qD w-c`~\=C.TZZ->gGƼ!ρe G^ 8ij(Zc-8Pꮏk|+䵘Ox;Kg\UM ˁ/07i94 _mN\JiEft'N!wCciܓ$+,&QOf`gplS;[B[&fӒ&;ǞKKiq 2Be(㭗,YqiꔄTP@ *TTP@ *TP@ *TP@Z3tjXl:YuUTƐR)l4H'8 `!|u-=Ud؋V !E,1H$pT r䎔Y6G>^leN>l#/*:Xs;dhPԴqmm(QNǂRҼ#f]q'Cm =OBHtiG OXVk=ԋTϼ(+>9@a#AMci >53|݉ pqP$ygz iAPRTOs^1WݔIKlD:Pee!~^]%2)@}qWzzP݊q n[qaI>kLc*R{:x[grOMxz>CECox@~Z4WҒ%#ԕ~UQd2[@u?RU K GMV:rGIX{qg5Ydt8-SR)N*t쉣\Js@=*7#6һL掐*OC@9}OkƬ1.37Z}@~%*"[9W O=@WVr~<'zGQdh*gz闇?>J@H$3.YËJ?  QʪNInuq.5IϘ>u֠˪w`J9*)#tܤM/&`aemcSos?]1xԦ>Pd[g.kپܐwin$ܓl!e7N Tp˪5rFZZ#8#$2.q87ɟٗM?~PVT7]qjK΁6 ^+J3rH1c9*fKvsDǢǎ@gpEsm=u12Ns@%. |}ڕsݝ=ٷov{5y]紧[]3*% vm[PtL7mx0!*TдnbK^RفoereK%iii*[8)$~E}%T@,]-YװEnVqjm)(m(t ×2.ԕ}Zu %.qUsԬ_]:#*TP@ TP@ *TP@ *TӺWTj[4j,*K-ߚJ:C q WsQӺEiq-/8IK[u, pm8HW.im@.˭k[ZN\d-lo-0%ROQӓ%vC{[@Ym_zb\a/ܚ;')uIg ;GYɣ 2V앥YS~\,v9z[ԯʣ^XQf lW,(a3%:R\Q҉Tk?k()56{H&%I KCWcNЩ7W9Jd~4(:krlW:g6c/3}ĺ?urK=m{q>: igִ>>jm}h]G-8WqʣR~\xIP!mR|8UʑGOKG4;+AGS<^8b?u*$p$W|n,Iw*2ʹ=?zh:a%Na :xNt1#Aqd GQֶ R% :}{gu8z2 {Gɨ:Ts ׇt@ZQ8Z(IR\ajVT4K->`]Վ{>XT}]r:|ϓ7W_q5ۉ}}5OqD#ui\Mz<T3E]a $q\;{V|P$[dlFHc8nήNtx} J@#Px#=h}-򻵎oy*WۦHk2m$-ǔFGNR,q?wF-5Ϟ2yz1(`W'/;"%2y:&tgј%RRS2}>i*6J{QZyO_ụC2e)gRYbpJC8y#M\д}iil(A:|unkڕm̓+?3u}s1/Cﺤx,zWp[j8ӍaqN$$SN/Xs˹[+{G>̚g4|~;<2}=UL E{gx=,[jP䅣߷\?h1=l#')kxBn"t#bizK(uSqZImS$P;To|Ty0]*LTP|~KgiuD={6) Xg>ҙd7jS}Oq!Hq w}--!i6];"lXnDh6Yĸ0{MR\[ ĕޭ5+%IN=NJv[L<u! t%eGJ~AOO:HDLeeJR:Pޗy"#Fl@=IZh3. OZpeJSRpR ز!@|*5t՝meCD#Ord#$: ]<mMlMHPF|cjV)Mӣ%yqN4m*H<+vUҼ䈗̦P Vu;ȼJQD{R`@%eR+R~#;kC~lM \@D4!>BI\5Oԉlh.rW>5[=]ď>+<kKը% 'G9cgnGxZd*$c-"gyk>Ƌ :`ݸ>JWvsGu4֋n9JIIZMS!yR$&*d>_k QW: +-~8)^a7khyoyU҂9r:MFaJGWG'`8*1$ Wy21O;N2+zE塗7+f=T0w.DW-ܚ2%Ci0jԲGI؂8kngf9{Gy6 W|GjNX[7+ ke܋qKؐ?LHW>ױ֍Wy ::y!:9nĄ/<``:-]0JL4Ц(}F:3n%Gųx::FII+g:MiWO8Y؋?jyqI8R-zy{x|2#jՕ)$+2Djq5rp9\FտQj?& +Wud>;OA5:(Ygufoqp.L嗑Ai4=;=El]2 ̓JU|*lPr܎rHtνd 8g.l1}$ґ4I3I>@e5#c$~6>\iGNa/~(h 3$}by6GES͸ɯ!鯌(#zk=~#naADuI$/3^j=yH6:OvTRpMS ˠu f[FTY^u+s+>gS𨃉`okp]kMwvێ*ܵ Nu8+SJ[D %$xUjӠTP@ *TP@ *TP@'fֵ};loܞ[.iBއ %IiZY+(J#Z{ heDԽ mLbɷΈ˺~7K.Sn6TtFn LRKfĆ`ru8ކ*u *C w w`8#Tx#ܨ+>Ѥ.zgOʊ>qc ϭsmlO03&B(2eO(+Ԩ9&DacҮWt Q7W#f{U" \T} :mդe@9mNUJ 8w=Gu8x>R,TѵMIFwGq?[#n7.HR?kԫV?|N>Tr ܃"XIlQl5.ʭ(WtϹ-'%=p>4Hб sgzl@B(LezRr9(~,‘qF:#[YS2e r@ji@g87tl 8AE;yWp =[WKgJ*VBd{%)I=ܖV‰Ч+ׅ50.}ֹK墼eS+# Q4aԨ^BQLVk5lwum;қ+wᯟ\:=S%Eӑ^iN&FŸGzsfU>)vY!(i啹>{x $8JVRr>^ҹ"-L[\*y?E$oYޅpD' Xq5YӅ%YDu-)Vǰ[{ !đCbWK%KhL}U4cݡ5)hO@j-#]K>Aq}lď rdGۣ‡ƈ 7[x-[g^kđӘ"rX-i1`xqj[5Eۡoԅ;a-c)) ;T3zpj˶nPBI㧥rz1mq~T0I**qa SE,d|c.++Q$}ɴYu8⠖[1GK[ke$9)J>#&૴p>–+ (ԌgJ*K CmcIAZW-G *p|nT3^Oc=~SSuZFGAӋcT;r$ ie(S![ڰ gl1L5:J]*TP@TP@ *TP +tL]"c}dE%SM) sA0L'JMgLh+L;{%X#;YʜY$-D(I$)$?BB %sqƈpV|R9͒ J-* SrPH<'Uܷ,iֵ]LŁn2d%5;Ѐ$a jMWȏMs;iSiR"_;G^Xi-D 'j'̟35eG =Θ`1 18-D G脕7<ã8&!\}LJ E8ӃPH ݥ"Sht!,q]m Jx6P ,E&,z䗌;agH?kϐ,.Ԩ'\.u *QyTOZ犼ku\8ъɜNYa%#jK;ܶӃc)仹'l$QTcߜw[6% *MtGޣl_6SZHH'$841V]aR-HQ\88ZO\Ƶ>~e-Ō!%@]rۢUmN1Frk ?|sV"dAg,MGuĮ 6+Xn+xK]ŧ KmBr3IqqDkϲeN:3_$::t}GaFԀ%v RJyd|F{g=T.;-{s{GdT>J;--+iĶn6#$`; E#q&"߼xVQT:d)!KOԲJI2GRkڥ Wn)ʰ=s^6zT,W:h!{B*52,[Xgz ˉ ED㯾8gw*#!|j7+wGeӤ ֪Gx_qkW o!{DG+RIJTǭ[*u7}iۃ:[I (mځƮūrlIPQdƇ!I 'I׼V} ybC &pʺ!2 Ki?z3VO. xj&K$tVDXh+ #WS8;ୠ+ +t{1߹Ԭ,jސqB\'F>׍#e 7|+ p8%C'=GYOu-w)([9>Z qNa)'5ˑD_z YWj e''X)HJ ^n܆ʳ-bvS.Ba̴IC-d LxrW V97kEv~%Eҵ|У R8eKS,b b{4A5BQ)i%#O^zTnvu[n13ԉJ-Č\yB=srҋ$unxFF敐9Pfc-bݨ.迁WƓ̻v3dסuSHBBUԑDS}XC-Gh̜U&3Iik=jc 6禐#Z㩵P2vz )\CowN]@{7Q g2t ,arV@+vzehW ;n4էP"o!&)hʏx~Dz׵ɗIO^:bTȶǿC%ߵRdu$(DO E.Q忦X z| _7׾5Gh}~lB>LWRu*1b(y yja,4{'RIb)wv4Ŧ"1P(Be*^w}J5GCE\jMR"-N<ҞUi+dҹyՏ5(:]ڒ~a#ʽR}ou)uz[W={S[mݺCXJG- %~%jK~{W#/|X > ۼm%*V# G ,Зȥ_d\:o Q^ɟt2fX؄[ >뎱6CN0hmr8 ~-lT*TP@TP@ wtΙ+Li{[$8X*Q$ IR֢Hm\($7eW{MTo\ZjKQ'q\ *Ci|i_.^q~Pϛb5j2BRz8TzGy\#!@UEco݇ P2ѓpCOR G#-#hpL,Lrg-zk崎9Re>R(hhVɮ7g\3Qʰ]$Bβm JPq^?t ZɮyV6Rzv%*_%j,+Nn:=j!?R)8BXJ7G>ήPS%lL/]-VUrz 4ry1Jˋ%C#a%))5ek$q;NNb>2^qy=cenڤvgNLVYQϾ(GNt{vݑo[Jz+3vy)uc8yQ'9r-bh3-3C=(4zڐSpL֔zm4'(Fכe{F2(s4F}r .8:+s4u{. Q.6VV]x|թ_z8[;*3=1RYN= ZT?wCϝ Xw;'cʔzhUMܢm)G6pI*ƭ&Vhn4IJ52!F!h+QZ\s̘cG4TojRG)CJJ\sH>n ?Ce|0$?ZhƤ[;pL ̝išNlWQ3Uԗ4˜6OQ|Q_I,j] lݭ%㡋uZvKTgmֱgճaӺu\W;ng=| ̮K+]N]$vi{Xy c@oh.c`Z 7sFhV0h3O/kpG뫸-,&+oȔvD}:Tpwe JTSw G6fEtF*TP@TP@ l6>NR󩵼kFMejR,SBJRQrZMC9ws7T-KMIG)r2=R$cն)PG!w$_b*E٘pa md{;u 4j6rؽtΘ"eV"G&UY`4jԷ;ݞkJF*wm$ۼpR01\IT{e!)Erv{s=G ŒSmxTr}v{jO:@7O8rHJnpcRq wK_{~ )+<%"7;s,8{2p8$Ӭ2I*[o1$wѣ$N q̥8|N̰ %v8on4dy1\Q' Rzך/8NjusI_t/NPIs/.*'>[dD"R¸7!G$jf-#'fۘ!4B~rMx(Pr9ċM-)z7-<HLF*i5^L1l=jY褓ʗyܱiHQVZ]8{ƺgnD]=3n'Pǚ,"6_\@ܟI9RլrlP<FIN쓂y';.Ih1ȎRw͡$nxҬJTY!  nsXbε:69Sʇur=T=dB39V)fkW"i;a}3"Je߶Jh<$s!|E>IZ;ӷNYj] l7w1cGwv(r5 A :{6kuRhR@Hp )Wnw9k1,hjncp୤I'%~n9BivvnrܶoO>Oڝˌ\[%Mt2;,R;BI98+B''R^gYOgTvѻRݖץdqY2s's Vm@/nw)@ 9 \Y%s8ߏμ uR҂.|Q"(1 inU=h{kOՂ]ͯCv7Lt&ݻP:evC v6#yoiz>)d[^֛h݄vfj-#{q#MPT{mAtJ Dlmo4RCn\{6pwv7eGwvMQ`yT[].{i?C,G]p_xs?h n?, {d/ !8B<@>gtpyHep:'O{ziV;{|>))VE$C*9ƶgqj(}7D_^\]oȯ։㯘ifXΕRCILt$4H4:4&CcGbQąv 82Ϛ[~,cHJy͒p{Jt@e0;ףRR (LS/Z^x[nB}T8"ȣ5Li]u:՛XBv18Bd$E|8?y\Yz.#y'{&@Zy*BG5f9K֋/!8t瓚d!xzEfCH_yՍWX G;e[G鎨rvy*h^2 u~K۴[ [;VuE{R]yxWt ݠHݡF[cH}S.4TqaHdgB.ݧ7giDƳź]aȱR0' G P'Ǿ|lb}HD*TP@TP@ ,"%aƋ̽FVTÎ2iL`}m'1GSH'%ϒ57#:Z'H EA (Do. ꔄ'>S:KeOiqOlK'_Ӛ` }8R-m80_^A2[AǚՄ|Kw=W4Iv_b^bKgn{ADϋCpZ̒ԝǒE)ɓ.mz?|4*OT_v$ߊhݥ3߬į-dW|t9֣kQ{pg&d정1WGĞk. .J6Zyzs;gT>RztC^稖ӆ&"\PIQY'Twge0fOPsz ΦTUI۱۞8r}ICYǜTvIM*Y"vu'؇;Lϕ>4WP ZJzQdʢIY™x=-_ rI^U]HdYq* <4S֠r|d*^#`ypKĎ|c6ȁսJ;YѤ=ԭNRmZڤH,C d xrjk%Mig=Mꈭ jWpN|yA\neRbS~о|$6G<\d\. 0'?>j9"w͝iղ<&DgH> ܕpϰowd3m^I$E|*)F=yd]GtW7€#Yt3DTWaMoɽ 6.JGA=*}eM_qײv+pa%r?46J' d2R:׶sTs1!AgԟR !}krKSZr -*mDz-AgЍ7'.6U%E<@9ǻwk*@:Y)}o]x!j>gڬHR)8HKmj嵏_v" DfhahݖIBHla?m;JuR#tr<-N0`ڝXU3ojia1Z-y ԣ@ GepVڢPs KAm`s@u(JO/.=Î| JҴH.+i'۵m¡"S$AC8dg*ro x]!𥤒<_^u#b[ *KǏ[<,_HҒʿYI6sBn%DK.ݞ58(p&%.Ľݗ`KP< '>k>gˠ[E8)zU)8SsK<ӌPL ʼx>yBSFT#μndٓVah z~:^BUQ:;"-S&2sH0q[rk9W+ChE$Iv>gmGNQێ3RqQ9# d9rQ$!cV| / h>CUmOl(H\ܬ7j9j:T6n/]b 9-vI>aQR`pP[)NSW8Mxʸ79 6,eDyzj :vϽIa0d%[LITv}Flg~5ˑGä°HHqyE:򲵓4QTy#d!pID#W. Yn\YOiA -奘ңq jrpq )3[}^j.Fۭˮ)%3I/|%QT.qi}Kf-⎑Ց&Nz+̸eCyeԔˌR#&6Õ[q u̝ FADszĠxDq6ŵEL(I]mBTY>$O$ErgJtw;{ RV.'91_5$v"?f;I,^ulF[qn<s]#Ռi⵨[{V^-h+RmϝsurI^3fP۷ػ#C9LM ȯi"hݔQFqX( cIJy)@x 3 &FG9\Dk3=ch[!^RF6l۬w#̈́Ԗ^)Z2V5;whGM r&ZY/4C_%-2ۉB3}Ax2J[,!nD|z5R3r^b,n0)ʤ*㭨y>U*&Ԡx>I<ֽhjho0ı%e$qWZ+>XąJ[- Ц\UykqԖH7C, ^I eװ?`&E)Lmfi|\Itm1W_3;F.=/DI;Tɐ4zB߮yMHsy;֊ z}9xx)xx8xO~#]j8W8>y\1p$9uUlQ&eѩQĶ0;ąc M̫("B#[J taI RssYǑG!lpZ0p yWQ D"mϲFp~肞1ӯZu%y6R>ӋmYBI種N>%Dn!8U7>Kz{vI|p.,I:f Vxwh)(J9AkX 'nkW/B߹+$ݺ忩wb*"|<8HX${z[#r>e@ FZzŖleUND{Ï)O`Uu{ 3AT<Ȉit!΅CWqJj[ YOq>9$|m܉$#0YĥKyM݉*HR -<QM$j_\%\\ES^R<;^cCgqu\U{ꪱZ%҇ͱ!K,% $cUzA3^A x L,U'6#kwn(.mQ5 v9#KcqR3rrFJϥxzs_@5`*BC+q_1 3+̧Dz3~ce|krYYݕ%DG c˗W:{M0K3eJSNC#ҨI"} Q n%o/;vOp:THFQE8ӥSIOB#\Y*]#Hۯ}بc;&bb$;ܭ.s=2߅Ez(F#j=pixkČ?ykZFgqYƇ͎ƳC{:E!(9m )ܔON<Ԇ,!~v+ =yzx|l/&q޶ ! θwnlVɬiqyyWw9Ԩ[^\-DNm$|@RrAUeZ8nhQzit\8Xڎ[= I%JG+njCp1h 8hںAy6dEܦO!Qj'd G&G*DyH"}䁩NA(+C8[Ne*A"Yl<"CY%EB!n'e47+3ZTD~=߱])OL%:?ӕ$epO>OT}pyq$;b? 荝 dzrǵrR@qA .E7 Bdr%MIQ}ybNrTklsWH񞔤t ڣYpzק#[m{FK[eIR u-]߰m4Pj\Y\ELȃSbtFL"ru"+7%m mJR)ܡMVu " s]u9\TTP Xhh}jV\"5dil1tn&W!E(Alpդ%9kq')5ޒ1oŬu]q2:A-MCC*TmPs:G:3j}ޛ jtMJύID1(YuΛPj4]nSk%NNA>q/Diw) ܒA򷱒̝w40G*>:GdmUMgmH ا~b8WӲhn[54M<֋R )YzRBvq(Q |r@)^qtr-7dj+Tkd'~JJv|ƺrs荲Fh HvlPDsHO3sW8*`na@Lc1Td]DC4hIn!U|"<9"O]mRV$$)ƕ&5̟Av%e5Σ[tʊިa֔p1Ѓ\G.E RVG>kH8үLOag럍hmBc֦ǎe*,d~ɤ_ 7i2,ԕ΄ؔg˧_)v^q2+jmgeQFU@BL8$6Rzry~qJ}/_-Ej{A"<ܦ]m3 Aּb/Z׭v{Kk } fʛw cAvc#C5L"y3H=:<#ӻDokmQj&HsD%@a\uŽs+ B x I}uz"\Y~ uJ%E,g Oޤ+27cHv_E[Ūntwpq^%*Q`2[QDn֗PRr!1 GFӻ'Ohh\a9$y\1[q8, #: h039҄c^ zSI5U'۞Gbh *WGMh>Cp[B4ʣ<FURnpRIԈNSo(S tu(TS3Smi.ê95RVsRupI#0۳RTT9<棉D|YuC̘KwHzP9x#tԱ"-OrHp9$q)nK7MHEpm1iLU ղߗǑ5G5jI?EG]98VR#ob,0FWU|~Fs+KWm'q먳r@קC9]&qGz$7pFࠢ ^4I6˞6НN>qnKGb{VOHemtWpA' +minBo>t,z}=>🐑(]7 v=\~A^Vn:FmzrLjG R,VbKËLX%GD`@*fCg) gj$Ey\dEyYymPV*Vp7)I2+DDJ=:>.gQcY4S3R:u^_KmhQMw99YT#bvReW OVȑlrc*Tj l.;8NSnvYp OlMs g'zt/K֤F9$R3^uG}i*vchKTƓ8)|ܟgcv eB.^p}H*S9$&d>M\pPumI 6$%Y<'^: δ=A>! $;zy<1yNLIWw!<RPw>)@SQeN<>@8-}p*hb}sBDoVF>RGq3'Bi*Y`3:J~]RD.5anImodnRX7R㎩Wy|V'.ԩy{ edzƉ(Em !R[{a^R )|G=cN [O`:pQۢrOh<ˀz)$e* 4)N#StfvMJ:Dm$Iu+PH!8*EG.߈j=΃k`ۤ )p(K䣟#|?(^q(BNyFܷ!R~g4>cPu${?TYzm)ku)J$q\2{.["ĻNIC &((T>',nVd>~u|A#u!= 4 XVp3^ƺOF ,Qvg\u\<95栵>Hܝ.cK1݅f %-47wZ 4c$zFYA~۵I{A46QS6 y"gU*49>@@u@<WzSקM8-SAq^-Uf{CqPJx'-7uCVۻGےT>EiF{^Kv}.VSaJGLDUI-gFwU$5~Wv~>U1R8֡% JRROҾRk'lBk ]?96R1WsTɢi'*Hq< WVF}YJ?{g-(u(PmJ=~Z${u I ?ydR0%\g'WIJ#48!'SOSeyCsʷp9桻$L1pԐ j,rPW07S^Gu(g:rMJY/'*E#2)Z!5ߖaCJmDԴ%GFnl[f9U/vЀOB>Y\`y]bR}@ ZBFM/qꄿjKq,{.I#5nwۈ$}ExwEڽܵ3e g$ dSdEB;XQ]hCiԐ;>j8.TۋBN2v+zV8|^=pq-!]bƝoQd-r?{a)ޥRɩ[gwxLdoIRApACk3άr5a>5(t(s:P g!/ԥ?KUGdR ig_Gp_qf1l-#iB@'Q(+lC%䯅%I?j]$ggs;Dql|U"r\ç g2q.R]$m[kl'#JIV=kROq%^T,O)_ q3ơG&̍o=Ġ I=ө:\hν<8I!ITpH#.qRNk=HvibetZvL1 O)/H緡r\ދk}^ukQ'&ljnרՊ8M՞0>rkH/털Q3Pp|1ǽ1e=$w%Gqj2xO[&`|W#9<|+Ԍq^'=z{@z85VNWw#ze0-`gc>`דǰ(=;ͶP J'`A8^OvErʒa>%y<8xOy3o5pSpr5ҧ'' R~竉ֹ xA.͝tXdN8,}6\9nOHz@2O uHf~Nhz#Y2'^)zOK*ϩ&?#o>d.6L3w ޝ®nM2עczSJKZһҥtPÐ ߵ@ET,CrBHWiJ4zY9$#͋O@Ȳ(g'Rjkt7&C\O!hE$CQZpdxkqdfϏX:?]E/ѣ8).]u[4W8'RBd)j9vK'1)<{N3W1enN9. lS샷4˨h ZjOJHyN3cMTUD pajO`'mw2OTP}^iDCnΒ#d8ÉPeNxVpk3Ԭ벌D]C=ɢ55`y`czP"T@`vA Ď"*Tp'1׎<=k:|޺Q s<%ӻ%δz#%' ܵTrj)d漫k0W96c{t?JxΌXLZbwM8[nT2ObHn]'w>U$Qnm9 9әfo?Tr}皯&OymTByUq#{4ьq%7 +HAs)<{x"ssBʺ>MG@^6zsI#ʹr=xĄ5gV~)J@}krĵdz;=3^zZ8GGh="[!*,(iK@{^T鮔O4n)JﮣJ' Δ'տ J[Q]C=JKn~Zإ}]5!\eKu5|Wr==tu攷n.?B_ܤ)K8mj|hdHp4q%y٬NڒFo?TR?⬭zԂ<(d] s`׶rN<^h)D4 RuQ^pP␔+t"Gq!E88‹=m=󻟮LꎓJ'zWhV "Dm4- BR3JL-t2q N H4D5ROAP5 &GdDJZ5[F3Us')>/])+GjGخ{:erR⦫AL)ͽjh`ځn)m(i cD/3+>1F'EiJ}]]8\[\[JVI)ï`Vʽ*J?,.[:9.(YNRl;VEOGq8ZR~Uϰwf'}[5MǺE[] $Sx57 .7ѩ){fZVpAid#}~Zm}b8I{< (#2C).!Q*5Gtm:'i=GJ4JQc%'qh9>!c\;ʁ;H#ʃ,Y7rLQv># GrJr+"6O=*ly(pįEJp~ÅA@qgknNwTU"/qidum0XZ.pOVO_Ϊ3capnV|Gy' ~C֩LcjHzϚ)RN:GY!i;~_di\j}cݜ+ZM+J!8 qux%q^E#Ljo6gJ@Tt.#^hwf&ߢs:5ԻjÑ, i,)M%?xqA? Z5/OZJiIyNrfﲘY8((i>V[ K -/,ֲJ3MK:|JiW9ݜ;9ݢl=dԷ!2b!{heNclJR7 $]'Ofv>j8 vwsB%mE9:־DgBbqt~-ZVi-1 y%G|[Uq85LIõ+a_!Y.GA=MM\ҖxIuCʑ̎t'_U"xwB~#7ģ\z|B39(ZV92"6R35ƃ#"c*$IlQ}k<̲}(=>RSx['{nQZrAJJn7vVpG\W)Ytw+vc%GioeNp`) WMRs JT 5i`c^5Ñ`Bz%CnQH424Az%Ŵ9tx0|KǢR 4jepں=@#wDmui'Œ>*y=2G;;)<V~cg(NƔqc+Ew>YH'~ZY8"@Jǂrx}( 'J#`9BH'J#xx>5J'(,# נ~h?yPY:(=YK<%C QN'qUR yzQ#.H-i1]# SnnW;V~ zXr86cA]QxߊGj,G_uRSC:(6 @s*H-6A_s]EiDv>e7Ib:#zNO\de'ZwU9JTW =kd 5n>BUsǭNV3I )s5*Cv*yzV9r%֐'r Rd|xS=OUYLD_ooJmtE:S,#pzaҵ>H-i $$@V|X[w6O _=aL1YJXtwyq+ϼsO+! Kd+ȜNy=GJHfNR+#$p9>QJHgVt5}*DHXgF@i]AeS2ԗ<1x\Os8|ߌ.N[r\P]w' 9JW<ܑk THdmQܩ99ٌp&XSTzd Uxz~JI>~ؔAOx& xOz^R:+*_#Ҽ=>KNH\N-%G]#}io HZ%-cqZ2%m=9I6p/:n*TT PO漓أ9 =sF[uqӝڎ ";| ZDugC$6\NH @#$ T4I#jRq%.MEheX[t>0@ǿ{뵾Qz]DjI+5xYn}xܑ=NY"X{6$([e'>a5Vµ|}L63xU Ud6O<8'*{ w Rss$XԭA!-?=OqPepX˵K{ߊ= FAy̡qv{D+xGX5pq(8,8לI?3kKz*eaB)iӇY=>i?H湚:?:&&dݻ@4 n3Fxhx(UN6ZqŮ7?%Bg ( z d؍4rm!9ذxbUc4t½GO>I]ZIy6d4Y[0i+^N\#ҵȫO|ZLH$JQu#ѷ*#WKsǰ(209 dR|}-GtӃakŹ9XmNRr>jxN>`۽L=B73\JGqDMtݸyB4Px) `㺌 %=xzpX }sCTrƥ3h0ooKȎVʎN0#&{.)ďres^RY$ #ʦCLޑhNі.ʂfI$N`c/ZAڭc' g N>ynt֠r>-ѕom䥷>t>4=^miÞ (C*)sx9]q)^ܞ<;uO@gPq!J $gs3?mhoG2#N|F>>yg 8] H=9@8(!>1^N< zc6*9W=)'j>}-1ڥe 2 ԢvU_JT3hK{' ۻ*U̲K3!'m\:ʸ O,ZḗV8`ܭēn>!rOI{ 29?;ɆP i@Pv2G<0\*K 27-n(JG9rv{FdkKK՜9δ\F6dzCe$1c&*'NE^{[-UNA%asb`ˆ듃KsCKpuG~cյk I𫚈F~,xMwYxG$I!$G^9S+Ai*W HӱDN<H BqJHzF HY$#]&Ey4c{![U2Z3t"J] $p=¤3fg6?fIdR{hv2oqnԲyJ]$P@U]A}1⤐ž˥xx9%)QLb#qn{dn#$nzWIId H՜Q҂E мmIP+ɴN~=+K{JH;GxJl<M{ -n2 0$PqҙPԟç$tUCn2OOZR|ʔ9AOc~z sfQqJeϋ#6 ^U+PJT H?fvMPŸo팅§Դ'`[c?]4 Z_+ -ґ'y B=R1^GJRFy#TG8&:<6[F~5ĥGq3&)-*r"J<$WޭG&x$<RRRRB-${IJ;}?V;HY<!^3Ӎ=@$Trgq>0%sPzK{B\)3ˋ8;1GZD a",'>M{Tx15-;&Da ![|fe[w`g*6Z4Tqސ#Lq F3SE3ނ+{}e엒ќ'9#$* }. +y'Ek 4 ʎ@5)v0kP:,ţ{ ;ef'^j:q.L}ܞ:TY2mDodwdi7}3z=[ ~?V|^&5?8Z*BC8u1w!sʰ==d}tM-ix5RA.vǼJDUC.旹'riPdY7g4 j;1>ֹ sҬEe+dG-[J]&@4GQ:(mKn>q=W5,XJ$ 8')*&>S=B-32NY @+<>7T Z/e=Ygነ21U!#4~Y]uF}jS󶸰J hSe!%M4 \8S נ8W no\ﺓY2,k++3lƓ&!v$Ȏeeqi I A44z-ZZ_Z![Hj-("%H@e Rn :z_?\np7! yPFAQ4pgR,J2g] |8rUnY5dt/SV"oOD0 T)<5|"X s@u*ڐp3 xx|I_8PErr? WWG(vd27;r %N8@B$ +4BMJ8OA9]ビ{J(¿7n vֵ,h*YCS$ȖB*<% JZX]Kz_bV:U؟k52.p]-kޕf5oJ)ou('JIt߇d}wx'DhMm)S!Aԩ[܅oO!Ɋ9I_K8fD\I_h< QiIzr:g4 ==Q tҟ}h ;ػ %dHڜct\ ;Dm۶ezrkwZ3\N7b +$f"e»Nּ\Sˡʏw{YO4 jR qi#[r @Dt罶2I >xW,xDq8FL=Bb8zgy_Ƽ&}) S2:>쨉nA#eDrΑpIQ\qRW#oM)iG 6BN|LDge';C^:TBS,E:5JL*̖Iιj΢ϛPB}GW*'NCc&*ꖈi)i(p=f%߮A.8ܔ$)yTaddƟrYr%kpiN8V7-<(쏌dFv'OWDxEFHFy$ҾiTOYR\RC词Qˍ߅Ȳ=lzf4e\i䱎S;q%;jЮdgDYxO`j\Zj)CivBJZq;\8jyas.$q#R&džƥ/hJI)Q#PE86=]WaHu8Dɯ)+8U>B~X/V[G9H[>cZScvrr]Qֺ9cnhBBz<;zgi1^ÙkKCmzˇH*hp{j|t lڕ>AZ6UGEP85/AVRBw^3IHARydRGN| ˇ)2 J|4YdV7eڧCIUE6Mv/tTyZ@ϡc Ufrp11w,9Ђ>0\\IGw&zvլNAL@*,8_>O5ir\[ױ?Fj4&Җ@PisJl#l0ܿE(z$[Vw #=쇵eǝi\vEOBS@QHTF},z)m΂+ƕqBkEg5I,\w(Rry=kJYjhHSkԑrڊ.U*c[s/$4XeĮZÎ4-, ,)kmJKPHPF~?<bPگ}a7u M_"T-js"¿u`r+eLqkt^.ճM3WгSqwNjm4ˏ-C{Nzn#TVksquLl$:;X,-**#&c8H{Bw{yiu@JqY˞KIZE-oXt al (`S@8[K!DWreyo9 nsԒRaDw -DBG6U,nCjwܸMG\p#Ac%C*I'G#r('$Ʒ>6T곓=k-1;YH\|xzr2* ͤ),隱.vB5s+ '$CGB xֻ8hݚfDc䎡t|.,AF~䲔8;#״s׭WdmRGJ~+gnϟh,ԗ`$0}J"I;'=#S#))$'<k*dt7SQҵ%ҞԞX$HkѥaV苻PˆFim@H~lG[d#s9hwM`k&;mKxWAZM꒑%;^H@#'8#ijU$| )v=;[doAk~pz>b+n9 dUڍ,*G~$Je'IPzg1<q,Ԃ1lyyx+#'~ԶT@$y{븴s$t/1.iDl PB0 GCS R-H=Gˏ鹎JS`/ =i1h ͥ]=ۼ$ݜQ8{8z{#bGL/jϠ=4}zӨFTcItW lE4`,47へRG-Rl"%Mwլ|3gqJq=ޡss^Y1R^!'a%.KIνL|ݼ !Ysl4tIuź.A!)5:-䒊N6K Ah e1㇪U4RgR3>Tߐrt'.zvNiI+>:!)y.:-<>6} `)S8H?2Ep|<>EB܄q6Qy72|ֶm)Jds)回&۲we_AK@3M8gi{O-[~gz{aA]m B،r.8IIBeAWkP@ 5>GiTͻ""dܖ(䔩* J<ݚ|tB-m$aI 0\ui4rڶ9BbVeluޘ9d`^4ھԊ1ڣx=Vn<Q nM2[?BDžo9nRHtm!%/* JTZNG>TzrsgjZWAMWF^t.CT(3\N;A>H53Ƕ^4/{Nh6ԅܦ :Zʷ'%@jyp1ǿ6g]Ȩx^*Tɓ˝J;*R |t{{/f~bI]@Q'qRқgM fv$>gקcX1"(紇$xV֚w`JdMY*IE:ߥ3.zcD&bXϴNIZPxuE.'•[}dt)jw=x(O%*|M4]\9WΧ-m̅|Q]oLhT9HWCyd`<_x[T@l̊H6̷޳0 H"ɧrhcU{5m3T@SŚSS39kN|p3OGϭEݽjTLVJV0INDi/uFyW }8"9E5dg1Gv! }UgBNOOW "(*P_Jl 83vTBzcurtyHExSN%H8( 4XPS"{[TU)WCwO}u7rˍ'rq#!rH>U p>HN c]XIUat1oqCfB%#+̑=XH jvEIn&ՖŵM[SnĨ-TRа95Γ3m?p7xÎp?%zcZ[.(Q8goZQgkOe>_@*HyTycFiZf"ʹJIʈ?5z$~> escy<Ԍd(gι=FA+zsP SkDn X=Q N,'(ҰT3PDnI@Ou3i[m \ #{@G5jGFʮ $zEIs \[ JAW8m#3B9m~3-̞EMHDKxk;yx6ۜMJx|@ *T%hֵ΂~/{˲q[u펨GwېR)@},.zOcUɲmrt+."gOWGmgؾγևb.ul*bM!K*=BI8 ">$D1G ~R}g]>^+Ie{B3 )mdi,)a@'8i>>֗qܮw+W{NTVlHBw┣VEFݞTPɊOeHqF< dFk?y%7\>HvAJr :rufRZ`l7Y\߅q8P)x3{$řקѵ&3D2O[hQz<ߦ, o&լ2@o)BGӒkSG\HzcAh`dJp.%C?=>d&VȜ![صeȌtB~ix X5r}jc*#Y"!ФHIW#I8"g{0"[ I{s}8dv㵖:gItApy){)z- r!*dk~$0? 8@Ӕ=mwub|4: ygietUG"<"u[|<6vuHڡ5=n% FO^ҹg>`OJ(+^YÈbnH$54vcKʂ Ug-姒u掓RWIQGsiM!V:k+:w*:u\gs~^v&2J>S 43zOPIHI'Q[l\[D㍌a (@>y&/sɁl$g=VR뤬T#Vws@r(8͞r,eHHHԖAvGI,'vGTn /] 45PBMs l}bx-dir[ZIKގLb5=r׏Fj'xѼju$|AEqLOr SJ|qA$MtE}BRO5?te]nr#00=N8!N_J$jʥ,raA#H>$/,6m[[m-0JFTrTNy$SeȩnE$tњ ΂pWG# {}Q&gHn 'H WgFdm*Do黄bHsP17!CW"7qi[ 'colt^$5$%E8=i\5́+pG]E::L7GjL*8E(*kʢ]gW %`qJ [Z h%*} G9ErpAP@ *TP@ *TP =aY,L{u xQ[]( mH䓟G1rҼIɷKsm3F@fVR ¼D+Hcԟp3ӑNъa3nqI}$IA*Psרk=(_z[=[czo9CVGùMns~V'9c1>sqJܣҍhQlEn'R^yS؎W%#U*'ai6t=+HcS.&9]W]i7{\QY[q=iJ6vĆiy-%֖ABP?NkgHux,a!|P*u#UX;>dscpt$d|yXrONBǝs"BJ sHAK>8>UW&~O ]2%룂D{r|殰`H6m;!Hi;Gp*ԥex>Go?@DF2^7_:Ψ+>xm@zzydYI+PHnR#EOB!QJd6"Ci(~gGRgmdiTCnN9 SbSlu4*JN r9&gh%F Ny~fsѰฎ)>R8~":W{ mH=(gy͞IOtj5i{Cz*ay%Hq mD7RܤDn/=VH‘sl}[D,+hWa&)vlxNGv>bhhڌ8%cr'Ҹgq;,<\ҼqAo =ȷ,~xp8#L+YGnhbO>b>63ms1>=[!*rB~AKdBfmsXWzBO}&ĻH25)G*J(9VVOA~)QO^ɖ{RVʔ@:2wJux1g&Nq@=k6q+>%[=8 iH-<[oE dᜏ8?lgE{AgQ, 9SM8S^9&gb^X(H JPswרzjDzv %jmME NJ,H~v:8Sد_nV?vD[R|v~"PHW#) J3(TjԢԒj^F;wߵRP@ *TP@ *TP-h2R8xG dNbve3J,q4mm랙9=|2ԟ"˴ߗv ЭV޹Y,Ƙ2QvtXRJRdIqhا>"]RR^l"I:2M%[KGS?VuDYWggL;܆O%=<<Hة*mdelDu2B*.TsE?KK%С*%LQOtAM1Ԛ}ᦚ9=vvr7*m8;B qOcѪw)7A=J>ϖaJ 'od U6I2~k8>_Ux*#OQ^/yg}s^07>և xjH2|rC>Diom*ZH$*TadHt(KW䧨0Dw% @ @ڄ穥+"QOpv +8>񞟴T:ӚN忴bx?4ڜG*ް8R)\GɥҘ&ߜ7nڡPZ _Q@~~S7KFJ83_S+`5KaFLn`zq]GSk A)R:9P{e:8p{A(f|$*L]wHi%nR>OϨj7a˴mf$Nj*,BvU̕r^-'vq^G2C-Iݜ5 Hj6ۻla6SaB>r}|8/<ɸ :CQ%o>ɋ6328wr$2cp4,$T5i\7x@!1@}TuNJy@d5xuZBy>GHFZT8':gekW%Arz6nڽ:D'R3"y N(y] u 8`]rᗄGeeiNzש]Uc$ZHq%$qRFTq(SyUJŽ-YWϸ8W"dOv?nG{:y%=(?=;NyGi%?,-#(='wvWe)ڟL泦GGz9鮑SyhQ'$c~zb=9%$G#(73\D靶R1=HO6{HO=}kz5.;S垢^͍^S*Zi zNa@HQyh埶Rs8'0l"y"+ udYӭ mjmĔ-IPpAB^P@ *TP@ *Tێ̛XӲՐۚBFL+8k ſy%پ% _WZD@x(lPu߾> ¶4ݤݶ݂B@?4x4Wq=SiBg6p%9jEzx~"]3Rn\VV N>[^[ex6!hqi^96K5niԕ+Ɠ8'dpٌ{O;S.$)9W{B1r.11㝑[%9=*+һ K10[u^c:-QSl}=e"Zi_'яov{G^4ΖFqR:Z`gX,rǴMe#c<$|yWJGiFN3TG{D?AIss9ugHs:zWH`FN:ק ּJ'h2FiJ.V=M}(Hwش= >ZJ FH ?2WK`dqL!q)+BRT8 Wj/JJ&'A*:GGxY}$%~+DB<θ;LdG>@k99o'$+z7LǘgJ0y*#GRR1xv-ǻqGhƙ̀<@溳Oz~8npQ:MudY)h%Iu@xS(4P@ *TP@ *T~̡{?e'=/Mg0#߇?f͟uDt,׽|oӊq .c1i\* ؙm##N_ޮ.^BJO޶d_&X6DVDHDs,nR? 03pt#+&;^FKa:NI'j }8^R$~ZdGb$2xWJOb(0?wE!'<-Bd?sp6EwUJӭ*RPznO#p =-RUTk#>g+arHO*h0˰hY"];RҏQG9#L'¢ݑЊ ȯD:{G*H9μ.Pm^WgHloZᛂޞIaH?~> &u%x(rEM)Y U~X;;V 5sj1ʃ`fQӻ^{髾k9hN; 2E 㜸Y@A^ 8qX|'.^WÝ$sSpLx^N xQm]SG'1QQJ6ҹ=TyW)H3x+F3^ďDW > 9RzJT\v9@9Ǒ5>'gQ뮏yCR^,㎘9' sOM/6Yp61;dyUzv S]1z cW@ *TP@ *TPONCXmv1kZH.-H}Q Z@3Iv6[4o%Hn&]b \As NRI#:mJPӦ8lKn2Zpc%wSCG-Q=' J`H8!;) 7:d[޸',HIJZn3;s\B|pN*'5:u-!甄 O@}4cQ nQ :~y.G-S w\:fw#tt~>u$?0gOU =,ړJ>'}G@\Z=Dv!*3r["sG^2'#=+ӛ{ZI8'=jwXŽ]o#U$)jlԗ'\PO![f9G==*eei*Pp|5,Nԑ;8SNU*vXcaBegD%gRNjCɸsWIU!JOX¹8u[$_Hw$}#S^B9g؉$C-!m!IT=R+#C\k}vY*؄OGkkgj>5ոt[s8ġŚ-GTjYߦ.)'˻ X5ғ:yP݆H'{IB+Wm({IJE١29ħfXrqM3R vl@J0}(<:sg+ӓqקiW@ CqПE YYO }ӄ::;ls jE"*9ҮJ*Dlrvnɢ(%3nEw_W0y'Sb7p`qOj'O.u+8”4@jY=<QGi\a>Q.<s aҧ" ڢ;9Ak,!-ݵs?!h5K}T7+V_Hyw.ฝa-ʰNҮ)WMv{^2LRRk[ 5鴹l.6gzJU%J$!97%u]ڌ8~1 MI EE;֧Tno$ZIzU8T B@YByGpMQлg^=\=g|N=9d7mT5RIRx풸!#j) 8P䚓p7ɮM{k;^9یw7nF-N#[-6DmZu# w>t5N3'{6ev >Y#J~۝7:M0hk}UeZ>n$k8\P;[i@d dN3۾LYTdW}CRڴڙw`8ՂR’@>}keΪ"s\zU4by aAX=+1h>.*TpϢ=ks1 Qcdes].LAe 89erY$MR'*<(MQ#S6ĩK,RyԱG2gb!!P=A1vW+Qp<볆x<'Mz]wC'+T t(h'ݹY("Xq[fuIN >J5!b5%[,T9)܏MP@ *TP@ *TP/:;*=5П :Ǻ{WNC~"2߃rojKIC_Bw)8*=9^u#p?O#N)oKR{ڰFrI>M3؝<^ }ÇֻM :J;) +E'/O®)D9\z} چ3pGZ\~b0Xe+d'DD$G>0?6ukRr Jhyĕ"ΤHNgd58x$ Ns?6Y$ԟ5~W?`rExQs^yȯF,u)X mV~iq;6~:P*lGkeC?CIRVA+=7;{.$$&JPTzQ䅝TFV p(Pu91Œ?ǚVhe\⸞P،1Rj7L5h֡֬YY(xyyggAEqD$^Y̒lUΎTSޤ0+$w7dDuA(u$㑞haGyl|kӐ|uNTxUn@UD۴݋GxrRWj 6L$qΐ6U6v$u#Lrҋi !!)`yUv}Vm)D SELgW3R;RF:<86<äFZ͠`kH>}X9c'Y:$}sxzwV(9gL$(/:n`/<>a PdqP|6 ~`GbAG%5dmkV!i=1DXzm.A ʏ^i=֐EE*Egxr5;VzދDbB cFZ[l$waJI#j@ܬeϝ]pQomܷw+fwxf#Cq]:,r hRBpxjY-[m)TSwv=||umx1Mq'v@ZnezbF{m[IJGRT8mz3H:G,}T-?/g:^G)+E:U[o[=d÷#GddG#} i/w:kgNg)JD&JJ(BI5LzU<3 m{~;Nۚܬ;d-r\V| yRѓw-ד *䭦ohn4m% )q@m/2Gv)09*cҤԓgQ?1YSc##uARSeda u5Ii=͢U&Q!{nJlX[P*OV.EyM>:VZgOd `gx֓w0)9ӦvիMS#hw'w~j}+t~N^U+(lo|#zY"iæJߚ:t ۍJWtV6GWzg1iVIypT3ShwEz<H#h%C O-,u8![`{\>s{m a⡛$ƻIKYm@%lr} -8 2}+J8eQJ}qb yǑ5RSP;\6Yx~3,.w6kԨ93rRv䎿^G7ԝ=x8yC5":? ?|ErN->O^eGTp~t3{_QAAuzpGyP1ˇ{Z6#,mƐ>u3 ! yI6qdcV3.bLOQ[P褔)-w1ޯNVҿpZM1Ti}K'j2@ċ,1T'Edӎ+NR rI5]{^BnURb8.[@g׍szvO@c|i\V*tÅFQrjߚQ{nczwp5&L2wM5~i~GV ˯t'Jbk7s}P6AV 4IRnnjgcPX~o 8 ?8. c[oPx-%H+ 6ͽCo`M>teʳJ랧׷,zҵ? Siaa6FPv  +KLc` weG.¥/-w7%cЄ`qW#D W,pIMG"!\HCQ)h=<̴D&=wSpt>j|Y5eFW['6iǢ=$]Im -[u6>pmn6HϹ)Jh|O>&h2}N]y8*m`d+`Kʊ|GNE@ *TP@ *TP@ C66'J6yI꒮/Z";-Aa! 77I!Yu4¥ڝz)ߤ2VJ9.eE/2!^ye?xdz*L dacjBq}0wօ}=ZvĩD7P܉ kI\I8~S{<˷-Q^%dՔKf8ZP@zҼI# dktքU ":DOuU7M^"6d]8L"a\NluC$GڸjhLFPi@I2fT{li]1sN?FOuG8r#gS2$~:=k2Ex#\I8Oͥ8F>5EdtFdNޜaܦ$`+*xI7%ļsЃ*["=[T( A&;ySEHXV|1d3 Jۜld;҄[=6ԏ59 (,%C@nyog~J|^%>\y;BqιgHf4>Nb+ 4mȔjVh6[+MKL%$ҷJm{,IMGu支i"O\ǂo>![㯐ԐS9g)h:;K[xr⚆9'POBޖ{}}\9qLKraz3BP䕧it2N*[Msʕ bUMSIT^]S92.+zi2Swt2J@!D9QiA}zSO?xVmKV5l;;?4LRVR}A萝P@}(GxT{kI|dx|5-Rݽ땾]h4~D}`풞"pOt|ŠVs>LjPj)IҴ{}_RwhP;*2&ݷvRIm$(,6U]fʒ}6]%͜mBѕZrmf.u%ȹ]}J#Sw,: ω𺠓[V̧ܷ&F;lRD~GKia\&;*1\{ѓ٦.ۄ8X)^x4O;v&~%!^Hc :רA%{[RϏiңq:vHIl xo;NrHy}iXdkqg ׯ4 J|Pl)iTlݠ bUDTA?z9?cKԥdj jIhKi>iT\Iu~YRǡ TCvtv4uc9l#ɽϽǷ̺)İʕG'4cu&y>H,O:[ܭMw8t"̣Cϕ1࣪W"P?\*TP@ *TP@ *Tzgbu=#mSqeYmhz;N6mIpb5oرꦥ];hk]7Ki  ukeGM<^tvM%~]үN.Nĕoy_eziF0[ZWްg' OzҶ+))IFRQVMmhtI6_/$^#Hie/:jL<ő˂o\#XdTϻnZi %}*I#Ώ!T<\W$6Cw(a=r8N* NyNeb/#EA-uGj$FiRS3NBҦIRI3﨧a<=[9yϊCՈQ!XVeIiEem>zzL$:2p8͝M>u跌h'"=8zm[_hgZpDcv{k qVCcX|E~J8BCJ;%7"xMܒxer3j!NvLJN]V: +zp=pjY|R"c29(>ׇ.RT.T3^0CfR 'fKrY;=3J[ZrďХz`{vϪӌcZp85CgRJ֜%a/@H+8$׊ͮ08tQg#yjVGJHĕҌTa2Z4R*N#v=d'p(g[T8":Uh*,"L{Ppa+H>dUlΠ n+wdQdyhJ2SIUTF~43$c9ɯO[ g$<ckӖkj+94qz茕$'1]$r{{Q+=>`A ]&yFc㩡;Y-_3 BChJH$ p+]c*R[I*~G=԰#3ui^$wF"Ǚuj@I%EKR7p 6Ι,jƼ:UT)_TmEB4ě.5g?STmCvq am?~BN2rWJNRkѷn8tU ӊqӑUZ_{g:-t+ݮ7En֧EeŶHJ2`'b$ǸV ou\z b:(Sݦ\Tkr{ۙfnTD;0HIĞʹ<}k>.xI^.w[2x7;R~}]nS.J)(lXkGSQ 2q%vCKt;IB60"4l 5<Y%=IAGStOjj o~dHK)1f<&|y|OY1eIn[V3o UUww/ '@=9}ޔHFdOT&|OLnRsi <}92J,C1yOTqvSg>uw5: )B W<>/3r#{ݞ*rRҝ'n+„"YcnUθ|fCpù_Xcw[[d#BTO@ԙ0{ wZḼF29~qRH0p6 nghFi}Kx>VDq CR j20NNN~=.\T*TP@ *TP@ *TTPCڨ\]jl׺;1nMଔ3)! e{JsF1/ Q:FSw1ڸWA9{EpQ1Eavs==8Q%$4w6OTG'M'<388zW,8=G)y BӔ`\IY] (ϛp%dAz%Gd]+8!>B𑞴XPVӴ@p:}MG(wXl#% $z u2J໣sN(c]3ȐezL6d^u:-AʆAO,08H Rק-p1Wu2+VL楺~ZyN/A\jNJ05Mpt 0Je-a+*@HXLP]))$x,m"ڡZf.ZmҐ! s.LhtM0VcLj'>"$ m-W\c\m* nj_UH҂# r+;dݪ(PmJW3{g+M"89Pps(Qpj;̷:W*SFTHHU~_M׵.UҖ6ܕ!s:BS@9iF}&W*(Z+*TP@ *TP@ T|d--F% oT[dٛGKLl(8\T^($ĐI̕h |jQY$Y곾_N֨g[?JLi\QQR%ѿ+Eyhj%rC }$XEY/\KB§`yOΫ,/ "ڮY OP|^YǙxyXK@e'>q$ڮA碇'ָY1Ԕ!a@vsGdk:H)<{TzZN=cgz@:gι=GeCq^)eX$,[ϝxz}C<~j,^. 6z`%l4z,!⑕*h*#qW'8ʻ"<~gz㐬pM~2σYBG>gP{cZajZVRr:\׎6wȅ}XUҢph4IjLLdIZImJ\})/cJFqo\WDMVԧx8$@G<"*&[$Q^Nc*Xnq+?7_d..t#UB~|3^ [ުK.}{}õ(o޳ҫ\gâwŅly)R!=6brBv-*$Tr;]b!OnFcbrq>u;HFHONfz\ vşvp9<\WH"810)K0-Qe6ػ3METe6&#- uجcHE/͗6.9`R7K[E \BwKY>ڦ::e2[ng$ =h1dSZiq!gypV~Zݡɪy6k%J LbSgJ=A\,66!*;EC< DⅣlppۋI% 1R{,pm! p*Uȉ?琎CC4rJ2$-YpUbHh\_2fޜkg׍@)GZ:DZw`vìUjZX}U5)Rr\PhmX,%.]1Rc;O,ly%zZ]x?!ƢOKI-J( }ƻ"?|H>vW=Ȓ#$gL,"ʑ<x\d?1u(%ؤkαƇisn;-<ǘHdjD: >!>y5}a?<>nG=M6,njNJ@'tYjϗZuJ:}uDm#c]ygֺ<(נxȚ?AH3hd=іi8$}y .L愍xű)(;Jъ >lEi d:ĢGwFHme@*L`![XHps"v"2 Okp" `WG6v!jֻ:`)# Txf9GשgE󁎞u Ͽ5E{g:q"TiJi}rQZG5 MO2(gG ΐXL55 mDw½ssJ%JEY""uCiocܽE#Hfj#q[!*mٲ޲<@IҥrgW%~ͽ-#B; $r}~VN+,~6{)NKS{: kHa47sN|F<7V6u,\a,i[>{9nn[Jt/qm (ZUrjɔx̓D^JלK{Qrkwo j(48y$Wr[5ݱIc\GlG? Alu;(*4~zeT[/XQssxm֧YcH_.S.!-JRU:oLUXzZ.i7 IԼ9.s cjm@+j Hl#9&B:U.@ y¬Df Zݍ9*j"u-9SǮj r˜K+_#9 yq@v}P|?>uَUOuɘ)O3gEIW ǵE<ۮ3#9k%c%,8BT[?tP%G\&+{9Z*TP@ *TP@ *TTP|o[u㫝lpֵ_vԆP 6%:HO &<,y(9l*?_?_媬 49W Ch#p ? z^ W\ro!χ}"3!h :}A~Z$m4tiW{О I8| Cv\nv.LG`'ۭ wqHGej%t;rr1OOG*HI'4?fNK z8t>U.0x\uG=}w(gޣּ:̚D*g *ǘ\RwK̇DcwC)4`qmGT0'MyY$D y@>jtWnV6qNO+GvnʖrU#%*;lb96vVBH=:mum0i*q~^%-T,lHB&Kx:{b\P xxxyx$sy2:hg' Oz"jOZqBNSǝzc;8<=ck~Qׇa@?/À:K#ݚ'$ׇ^33׀y;R|=}QH$orڷ 1'Qi*esy!c#l2J~8gԴ`PR;HP]rv }G,MCTmO$yTNƛ׻ ,2,|$,z_&K sSgKB9rakKB5N`zu<Δb~fz;ǥZÞd1i*T21֭gJ,q)yO"\\6RrG;[ ~z;y{N>>ȯXZu-pRZNGxHeD .d0ҿ:SeMC+>Pm3KhO}'M,I<̋#Y`A%]u~%8LqGI''*k>^;8Pku=¹?+{fSj)@+.sw ,:iCmS#9>Is:L̼d 3-H'0>_.K.I']h(鬹s4Ziw}KI1]b[1+'nUՁ"|DGwOeyOx#Sڕ=ٗ`Bjp Kg8rRs`Iϕ"<=oҭ|"ݶl@o +Q㕭]Tje0Zb`gO'QkxΣktBG,'̏J$5#OK!盻iKCyc{[.4ím$5%,IǍ<+I̙Nx@75>*>ʘí1x5JZ2Fﮒ{Aɠ OC=楑 & *Qԕ?U 'yxz}ּ=&cm ʏΒ:HARB1ֻG.k8x-CyZʈ=?'A^9tl +F$hQH#aJ92d|#kUzxp%#9: ֺG'6Vqv0Hɳ$(+ +-Sn d mB-8ϝ+kLVb)=Dg5 -P $~T^V :O[C$ǎ%$;#xH \B{̮F}iWB⚔5 *o5@2ɪ<3z~:]D3G5}&ձ}u4ZN,͞rz".2!.]Z^4.KPXQ*#8HGەrI#A~ITWηЯftl彶ZAR$}أ}ɭ PZr \T07^+ފQrrO^KhP@MI7AhpsuvG *8g!#?<> k{%5䠥2k{Fiլn0mrx?v5ͥRBJ)998zWF,V\>^S 8/>>GDi=E]ժu"m[[RAP7)1;i/X#rdeLk%JNO joa_h6ͻ?I3gڨu)R:Ad8$GjF3[ᩕOH7:Rݵ&} ܵ%%g{Ե!8J 'TTݜ TP@ *TP@ *TPTP ''oIr^tI s.HO-խ]¼<%(B;MA=eT”fQ{>N #ҫH#IQ2Dx2щ!>'&DC]܄,^ W =y`rK^mVb/ PMԓ&wL:~sJ*VD!'G/  ^9=s@-\ׇNr+1dU rQ)?8{qh!i g^k[S"P[v߉_P"Hcl'Uݧ+؟q}5^$Kԥ͟_ju \D{ϟOvx׵:3 c7JOQTȤG(4tS>u9CJk%y'\32"9c߱l ⤉: y59: 9~;C֡͒$9~}c j?|j<02J)($J+d!dxOנ,'PUvmSnKm J}٥7rDiQB@_Ȫ>pK5g?5ufw:!HnKK*6Qy]jKk"rJT۵x+m[_U$Nm \N?\~EWtpPm_NH ¿CQ`~ҳQ`s'9ɯl6(+Pj4tPd!\ucn-O/R&ex-T=y

Jtr='q .æL`o]7sZpң32~Ry)!mO8lUA_SUP@ *TP@ *TP@TPfg:Ѫ`=JDYLJi,)9 0G,C^ė%FR8 *5H{HRBT]~A^X>-Uji:2qKvv,6lDT`s]Ck\u'e#0#uQ:)i9ֺ:LK\rxHNZԧr'p iIigkˆ(5DT:i=28}*ީQj+Ll}9OYEV54aSN==O=H*]3#OY'oir2\>@PRBA {vʜNj&L1%K}V,-kZ%DI'$qi@ *TP@ *TP@ *TP@;ڽč.K䙈wOХ4TW.%iB@l)N[B${BԔ<)'#ҩ%ʇ {h+X^:- )VAd2$ڔa++hQ\3gsvb4ҒTAPP2؛Ǖ4 9{yJ{88^݂A,ݞx5i`pEx̔Pxq{T$PP}ƹغ"YwʁKO*ngۚ{!`sE݉]icq@k:qZNO:3#!N,ʁ+.Bs ؃=*#CncԌѹ\4V+cܯ xK%!ۏ6ڡJ֔&?xW)BbyR ҒJyf[=4D嶬wu?MV3=#i#qT>eJ~?lGx׫s୳N|ϥV934쏠;)5{da1. 3^mq=@$|zWs`IBJI;I=#Фq5I9=(=>s^6 zJ2sV+Q2+O̼+ xV̧O踀OZ^ hn鹆]-YuEM"#|\Nc $YtFEyg}ҿYsW*vX;6Ou 2 )9M(I)F<JR~4$JRʁJjo?,sK [WpYF+w#c]I9-5TG\jΠ鐼/:fie#*^\iM[oh ~꘮S>5f9JD4=9ʹ'd)ӟby,,Bvyc Ur9ƸMQD~PNqΦ䈈tof !-'iΊ?Ur=Nx֕lw}P]HQ=jNHVn듣[ cfv@59l1uHIf9=P-EzD-+y2%IuAyB[HZBoiJt%䀕Α<07eHy=bFaB~Vv GzSUϷWTՊ[=N->l!)Ǐ9L<5ՂpTRx-,68'yqqKj@(ũ>oeؗqwܟhu:7@66mkՆ(ftYD NG<>{gX漰^>h=9(QiӥEKTȒ۩ץHp-YGTK4>4[PRpF>BW~ygz^z wsb%Ԟ^I'-C~Fb]9 WTNh6;hBE|p5҄Q̦j+}:\ (:ȍE-wUðlj?u([ ZSr#":m+Wz]nݡ G^Ibv9X ]Yځ:5#g>Brh=H:@zvs@#$>AxI[N\fLUPQG^v#WI:oľMI6Vػ|e>kSh6FH!N R|E enp Ç|#KOWv{jbB72pH+QQ')o(BM˙g"@ *TP@ *TP@ *TTP@ w4iKw=qrpm l:JZ%C p@=@ h 쇶:&׋p5e+}y#לfzTR&Ƈxp +5Tq)XT`[<Eă!J::Rt*a>huMp;+&蝪Фq'FԄV莎2B~p+Ǝ7PGv2<"LR (YVr}{;d~~?>(WR9~ygTz|KsiWr6ZשX +gTR{hddp=zɵ)W(6HKTؾ kN$xjWƻYN^ja7 ׽b9Yw%i2BOē^<~Z_jnjLAWu޼ ( BJ.#ה ?4QY;ܜmИBIr#rT/W-$3܋<8-ɮ$H0yOk;c }H4˄+(* 3ϋ՜z[|Ul򏸔G&>N[G(VӟzjJ&qБּiKmr{"CN廴zI>WQUmpQ>v(~_$ OygsTT68埊RCizrxd* ~}ͶҋgCjp$nH[[{SC oq%#*P'rteKEYeNJv\%6g6q(%- IiI‹lh"s^fr$n2vLuoԄ'{)J8J@=|xhP@ *TP@ *TP@ *TTP@ *_fTW&3uZQBZRV$# z 笮hMA)0MZ*u.(wj[P &ǕvSKTg2G|5FP.)$ (-&v8W }#/ 8'#nqhor"8M#t^CiPSn$-*`׭Q:Hڒ|+\5gI֟hmuޚ8Z|Ra(VS"J;֍E/0B?!8[u!jmwٜ<|$+ߓ?hgy h9)91,A2H9>^H¶h<'2(nP.WZnkn} 3FQDx rqaLRDB2P0PrT J84YuԶ >^N%1(KOF *uI#+@{PnisԤJYTۇr@R0>hS;0GJ(IXQYnjkYi eilƎ-"kG4~Ld8tXQrkAQ5垤2&Д&Mb7qGԂxydh\L`4Ȉ6 ~*ɽaAC2N܁*R'+"I:^ZZ ]F$e9nWx Fh/lDUqRdk+#'݁klZ\;z [”Uy[<-O!FG\_pT|/5#̟lqV7 {n)|uQHOG*(z9Gi}j.8:'S>gʋ:ˬ0 㩠r.634QY֚=˔{X=H8kod6$??tN:| 1mCjK3ި!#*85hZSۭPK~bȹ\n )Ɣdω]ZW̐Tu65&񔸙MhӴYPk+󷧭)Mm%jܲmnQm@H$QS)sUȨP@ *TP@ *TP@ *TPTP@ *T)v%wdo~ޠQHjbu@%I;$(X$\-Ca1%koqoO &y!%̘ എynVT-P!H KaXIP#c5u^cYZ#)]AIBnky3-KXq A=>[q*C95:Cn Mwg"4.9CAi>c+ +WY5{~)159R#]4FwQ(|=@ v xޒ(=CVeQu+d9Sip+b_4}mrG a $qIu}kÅvmPVd:;fjRG2Gfc,FzAgWskæv^ %Y&Z+HIq"ZVGJhsV|Ϛ[e)$uJ>% <>A2`^R%štzݙeْl1sψ}y:M3om8rC2yUHI8Lǖ99?L$ɯ@;7~B\)4,)Q̅=hr1N5a`wZJ9΂n:^ZJfXBH{w\A雳NHy 6WđH3.bjqkJRpyw(KBꊓǗ#ԶVq;*B՟}{gGX hvp̏3+vv}R\ Z\GO\\mC Fla xEv g~o.#ג}k7V}BfZxqPpn;{-ÌJǭ 7gMNBSRtyCZ^NJSI?XΔ{n5g"K;?1>2z^s:1j弶\X3ЊpGqGL=&8Q y*'b[ya!NG*_kbh9uU 3B~szcdY%ڠ&Xj:5j 6N%}Gc]% &=)frVT̄:ǝXqcijnT+怉gyt/>khp7+]6g''Ѫ>N]Y}*d8\BI *p>)`tוzl~F M:*TP@ *TP@ *TP@ *TP@ *T\YnvͱfZe36#R^եI8RA1@%݂Цӂ>y1D8RI<($ɕsmY 87$5g.7}#'XȞ:\S@)n2$F<zs^9'9:mp˄ĤEs^5gET 9bTIG[kWDN(oG+NAGhpF%xcn$v/u?=zNJT?#rywHmcJ>$,uIZ8 p2+.$3^DA9cA>W,!7X/DV}MsTwNaifL_m$zxua6u^DW4ui\BR#tpݎT>1OwJPHK6𼎜~z'yۛ-qh={ʬBG-A#ז{.^P}y. GwRȂ9%nygQ酪3(#jTtN\Ob*l3hC&23Z)9*}yGh1x[M W yק- 'ҊpeU)* / #EY劗$րNTIRHmI76&%8 2[SyZ&Hw6#@sE6wc,&m?O@pO,s,p̫QIGr?KeJp~B<bqלR]y Rn<;>2yILZA8XEıs,DZ'"q}ֶ'%amLٱ˫VnzRKL-;p[K[ci^O PC7}Hׅ(b|ED"N2ԉ4T2czpUgt;u8P"R&SX ^ ׇ{t* ? '[JwhR e2R䴧pњG5s;$Bk>j}m5_-RO'"#$*:Q]a~4Y3\Nk=;оJ4YT}}yNt|#'n*/nGTH壂ji-#RM<|,x"86ݦm0o?k̶x(%HVS8je[KrĖ˪IJ 瑏u$f  S4qf,vgtsƫL\ z~"9@XR U&=,6=HS[kIBsR[eIKOD?-Z*lolI:P|.Ri2fO2+@ *TP@ *TP@ *TP@ ?TP@ *TX~GW.Elb2 *.ҙ!R6;ׁi,U|t>BHoG^#ֈG.$sti +J4Fr8"hz^\dq*3n} H5vob8o{.iIIUNCC:Gw1gܲUzt'tF@^QƏ:寈$?r9m)S#>(x#oH菪^`zx̏c` {뎩,s%dIqJ*+ҽXnB6Y)*F qQJ(-%釆[$G :IR*VۘTmIX?FBy33bʳ݀\Қ>/jN?u4Y^aDo U*Fz)?ѤQ}5搳ޠi29h"N/KiڊOhzn%6\$SEC;ܔ~itYwTЀ+Gr .3jVC{gcʤX8!+'*U93|}W'LCZ~ŒF0Pf46Wh{[ dckƏS: Q{7x`ׇG "uo3 <"s@Ϟu,fN@Q:BhIa^m۶}"re.!ХJ<9@ Tqv^T{"ub6> 8 xT_)2=zJG1ƺ);<:W; z+pTGR{58h݊? ѿ ͔8H]w9v>pyJs'mnyOZPDL`xD  tL$=ay[\Rẉ;[lC mONzTxir.oIH#+,oB*Ԟ8+ViPU]ԬSv֑ڥm#2bQ[sh(H@'#қByG IA?UƑlz#8I1|Gitv4$y^ϼ^.|Hoa3en |?(zǸot]q#*}{:<;>`TM-.&O|N=ˠmhY2 y PzW/!fvO +ΤN-8v)k#)H_x^&`o͓uF`8рw˜3VttF$5JUW"OjU/OQ3誜_$_B '&u蒞q"-E rҫHMѮ2]I$(H En&9m&iJU힌g/():evw.ag;dT술f똯Z k]Cdu=P}|ւ 3s_EIwrm>~B}4ω3ZnDm-!š/z +H$tsWs\2iwm)N:R SIR9Hx K1lU:& yJq'Dѧѳ>,pҌ'jc!CdmHB60PsWhrmiJ|rP O)x+Gm-vt+X?w~{tr*_( ,`%FJ4ibB\-lMl%EfX![ݤmVS|zKg*Vv.1-nPf58sŭnTrA 9ZԏVPWg멱(^i?$Z!<1\H$krpuC>hrr^lhyC8]mc}SSX#WQokR8o ϭKrH̽cTYҔc{-½dp FN<ԑ[ F&U bHp3CNǘk'ZU6[Hτ c?UE)([@ʋD)pCp(g>Œ9huuYJqj(AJJI$ w)&!Hɞ:vdr2[Jz(p(1]5x 8dsO?ً{"cv FGUdXH=ǭn{lMaD坡ղ<΅n>]y*ndy ;ZeQD̯6@kִx)Tm@]j,eԾΑQ34˨J]㤺#kjEb*ktvk{Ź‚ V23.` IJ"⫕qp!q) .2kWX 7ķy)R,hRF8#jQ`kI!8Ǒ^" !җ@~ug:O-!jw Sڎ l,lUF牺O9@r]PG!4Q;: @y-HiM9z^v.WLu Iز㧟^dgx}c9<:fxQeqR%˯ϹOeE[q%d<5Sƒطfst[fJ52Xb߯udm[=O? ։zj[JP!sAj]JrEOr܁wYCyg5sz+[Zq?ssSd!c~Z gj zS R[OA52Ŵ'>Wc TQ/Yy bXmݨ!5Sye<85 N$F>a]&Wq?+ )%Y)yWG??,A&ՌaTeZ(׎UwI7ֵ^V*@+"M,H}II!̸nQnu#'́Pn>B~"}/,`m&i N5l=*B$Z3/b!X<ꤋibnĢ9Vッ#q2ؕt]!]x{m}s YNu5ԔTZtҦKKy+_3 !,#ғ6"R[r"$6M6v‡]` V6a9(^*q?/z;-}w[n߶nR+iL IHh񚩐{Na-GZ"Dn ӡe>sKv{53LK L-E=0+[1%,Os9G)5MW[ZMZZs+^bE@ *TP@ *TP@ *TP@ TP@ *TPE6g}oDYV~!1uj*QVR'"3OӸ!% #ĺG]Hb\6jTDxIΧ Jɘli/&qz AnaRv GnϨg>>:rPJ|pjD9X( x]pkG"!+Ω!nBUJDbGѸ}tÆ^ t{Ղu6fs=&3t9 5䕪=ffaA.6<=!ʍ!gu#8'{ˑDngEgGcno'h'5 bl!H~5Ч#?xO;c=vcDhaq ?S;qbnH꤃qxF4Qh4k<K$6, D qA#$lU=pkȜN8':l&3w=+k䅨{rw-oUУ502,$`$$>[y2[؝T%|s۟o]7\j iJr)JJ1I^ 9jsY[DRηe RRO*6@ H'vx֛MnU][U+m-Ko#m܄ E?m2겑x8Y:Wc&w;';An7$NMsqg7ج0"\gn}M.|TQJQH#92bZru&!|tɃqjָK&x{Z9U:Cڦ .q⸲KaնTbϏSYٞ[u=4#\+BXYFuK$c-3Ux~qulnd5f$ d2E)AK}D{$Ji$(/8-'j1WVrg/ ٵ ^זּqL:-\E>w$H#>g6 f2Sξe"qIBR<Ԣ$ 7-,{$Okg/I{o~w{@ܵ+$y+ٕ8EtUy"!!NP3O4+8GЙϺ]R>-DG p<:*hw%~̊$`abyN} rzF?mn'ι[\ޝƦ! ^T%Xeqd;T|4&=*LH<8j˸IdԷ REؒ;A%)̞>$l܀) $3% YgNEd.ui%V?=W=^ʽ6SZf&&R}Rg_UxELmj#ҩN%+mI8*g4ԲTr$m}P,k"Wj Dљe% u!XrHP8 ŋBKĞweg;~7%EnؓBg)+E\{Cv6֐{B>p:s#cq'F| Ϡ鮗ɖ;O޿AVLM'LSC.-tJcs M[)d9H*#Uenܕ~EeqBrR-F$ڹɫi&yZۇHͳQXJ\yR;Z آwx !By?]_Y|G̻S{-ֹsiOtvav%А@9;Udd'<3N*oh'5EEn--j=&\5LպpPJR-qƷeԲRmJ2rS-'o>Dw>Eף)_LhN^tT_?q;?60B})-wlKa;Հq|dRKeoo-PMhvmt/8ZqA 1P2GCC`'p漳'R2{峸}^T8R~[,b3 HXSt'{HKʎXL,͸P͛|հ-a>eΕrt4$Zn jKpCa4FH#r2I [/PWus@|txНk"nRt|TjIJT>rH8n՗q8;iQTy9> J(V{ycg=)DǐEcH%X{AHg*PxdRGXg(% s~Gd#K;ڔ) )~{~ j>%f3ļII_!3WhXgġ*?ґ7q^e7Eι; 6Zoq0w꧐:T,>56-J8u9"vi GPTw>Aj)\ou~JE3GwҏN8,[NhNqu:q$&jeCWmXY<Ͼ˫N=Zj^U6=1f;rguC1bo%(@oywJ;(IC!i"<҆E{37ί"Kt []juq\u+-m$'4<C'R OJF;@Z2b,RBA*ߊt rPr+8Et.4߶;f˘7;TvW[w88늛iuprLؘaPEO[U.qU ,/Ɩ(V()PQVBjgN;Uږ0/:ݯ 咜:>2G=Nì$%FB@SEp7Y0jJRJPyR. \~G1]Td*CP8#=3A.EyeoG)uX!ޓ٦pz)ًvLŲ]p!%E(BwmJ@g3cUIy$$Iy'=כ7RW,8)K$^S]h_vgb쳵[Éoco}ǛӲ&3kZ*%D65PwP:P%DOsRc<)qi `~0 :E}⌔"u*!XPr15"TRʓ&FAHߐACg~wB@cWkE`r@>|tqFx+GiQ \K%X&IJ'WYigG2Ws~7I(RAN|D%=9,,%*)UN'E}Kl(gOć ;QX_^b:Zˠ+،ӻ*tp=pˁ |Iߪ|'WwxiGժ(h3ܛh? 5r4XH#3ԩ 'dɡV{ACQ0~ Om.sѲ{ڴdRlc,Fxx#Y")e ÑfD.Q(û_,D\&Etwi{B']4p-J.!_?‚xC3Ӓ.T:oP[B|S`ǭ3HNyB[.==njo@ 5d8*q{FT|iej{QWޙqT׉9O5=\}"S#)t'"@<تeh--$+ogvOCR #^r]϶eC25GPIW~t$[,8s8iX%' k&U״2VHTY9GBۍ5 \--# yMnWDD=j,u]~.Os/`QԌ`LB 󜩖ʰ:F5xL JCK_2TGsHpx(DRdB@#^-I?Kc+gN+w%S_w~*<ԨMiK3km/)He@)nNC\| E.)Wx 4. .&Vݬt|fRu%I><7O^{-uNV$7w8&]\!<ٙ*^ћf^q;k1$n)o )@aGt?x&ʩE@ *TP@ *TP@ *TP@ TP@ *XQubVY;[푝) uRj'1bG "1Dm%rI[i/GnW S=eeF]dFC~C-4RJ)JHRO5%7OkW&>SNquزG$\e$GRzV=NNE6i+ؑRXzCMRPjeyaJ8cw</"zSdgmnŒ|doqCVpD+*rsxP_ˆ[r[}ӗfkO`DKz; :$򚬠uvogO]nY'Ż̫kqwO=C.t(bJ׸N[ -wĂB$O\S-eՌ-[w<ʣ;!R*ڢC`}tZ{9 P8 hnzզ%C bmE[<ԛ}Cjƈ*]=繰yVr(B;xGTJ4ԭ|&%20Ch9#kzG^Dؤc$)*!\|r*6[GQy( (N@w5Ӓi}%=IQ@l6M=0,$ckȌ_ę9Jϱuh럢 <˖tW{Gox=lmjI}Dzߢ]6̓%G 9KN9Uj()hN<K06:1Yr*(#('=&xg~`6KᏑlL?WnAHuH8#)=y OwDG Y"N[Y^ @ΜG#Р+s^X( ) ( "mzvsؕuFȕnw ;NڢĨ[8[np0nlG.j+Rv{Pimi>'Qqy%)Z28QQÙIx:io2֛vO[LrYSEN%Hm[ (6@pɑ`{Eϳ1j/-x5nҺx5\kh'w+;ShIkm!0J޻\*>-6#.ۊ+Cx،g+@`씟>pKo=J5.< ^[T;|,7;M$┼}ߖc;5xjۖ(ԣ[nIHڒoon[>#r8r#m+n8ܚKwQoEh[ɝdZ$ȎrMXp$}TFP' 55\rQ}|PZWEGP28~%^,Dq?Zv5-@g*Kpmb2D`ѷJ BMk:/l+r&1U[۽]UOw{3$PYP?6u Iϟ&|x*5 =MF;S~zKY4lFAg͍-)ϴTױm#):]G%7˝w\O{/-RRkEI[FPPQ[fĹ9ܮ}re8qQ:Fw&kLz`I{BFy1 I+*B4MvX(C~jkjx qIkF#X#Td8JhtRorIk<:+A˽FOrȣܽ?@ ,!E3񔤦9,$Nr-u\;dbRTE 'Mqi}Ŧ)'@ɏe{V%|Rx񖥭j J'xIxOL\b`<^vDV֧u-kQʔI9$ݻݟ7ngμ<6lI1#!$4@ *I)=9IH>0$ um}M8e+NqEyG26Z g)ݜ+>^i:MˀI hxQ# jK/ɗ?\URxF )a nl%;BHWG'*TP@ *TP@ *TP@ *TTP@ =v|V\'W;ʼn+jyi)kZR$u:[.dY LF1MRiE$$V#_>O_"mlsWo5ĵ5qF[Z~)u!/%ʊ^)u<89z#$JjoJ{TO:GKi>*ZkΔZMxܕ58K+qplpUd"-j$tBci,jV(۟j^*RٷJI6I7IoR$ x)5)K5o\V۹6{w-8!!KAڕ`·N|y}qAҍr3w(ct|KCl@;xV嫟glBR,$D[n).m> W%$ )RIZ-C GNJOΘ%}6ҫ LzRxh-7uʚg%OA2N4+:YF=]o~ŗ%w *~%_qTn a*]vì}k;uU*2/TTGY-ۣ<9:dodD-?+t}w5Ad;f&H×mP% .<.Z,J=ꓸx=W-Wٽ.^3>q8bUj䧊1BKNڼWo2P,W)P֫j(oCd-[D'øe'p8%$(ɏeI]?h?Hd,K!9tKY˚Ng}J]ӚD}m1zPUn=5ه[E埣{c6lqźq}݋|I,";E܇烺H[WӇn®Wʓv7'{ $ bd_Q-@ҩ̽{qsja xOWgT2z|Muk=]9R/SmhrCJA5ª)x|^1R *T!ȒckWP7r7!AC=dٮXQÇ JRz g^#n"ھ!+F.JB"S$v:+aN4^rk'@seT7$sW1 IQ1Ђ0xE/Ȇ؝7L6@̿t4J8΢&?W;-mlF!B%KZI⺄"RPn2Q-mҮRt{|6|(E\N-HrBQc(gm:t)`,TxG3I8JEom~=6|8*ҫe^v߷$(x`cʫ;$]$uG˂R oݤg$ :Z4ޭW'Bb,g<69&JVxHDÎ{?vyI2XiYjS <2#G'|0=k9jakg*}/ĠGAVcEupz$HAhi]jе@h> hΏ_cV_0Luu Lb)2v?< kHVLn#:>|rK%98掬/blvCeZPԄQki<F>1N&t YqqFhiޜ2$斪6xJ)ZB=笖T}7 zXÉ 2 fu'Go-t>rΒW81O_^"HV5dFZޥltI\ ZqjC{FYݜ}+pJABy9YQ&}"RJEQ1X"RP9ϭUeƵA!fdM}Im#:ꔯ VI>XI[H$ŷ؁qP@ *:SE|Caj|*Q[iV@dR'FU$X/pglAJAҼ,maC`)RH 35(HV̏L*3qu%5m+W5cl` a7 /-ݤnm!).|,˽ZT#Nu+SKI)8?]r՝FM=^ ku)[ib#/H,mORvn!dc4}&3IsG})yJВCθC~!$|Hu>Dgk'DݝePb<~4TGxJAGwg!ݡWS̩W @ YdNQ>*6P]gZӸ 88ϡ&`zg?;vAQDŽZ͡$'*±ʂG'y'@z;D&x/XNy 4ڻt`]Dd)Ƙ`-lEa "m#əcMrQz":va-sL+mC2WuI|S$ES]m)B|LVZ$%ͪ#j)RI M^ըEwJqmV-3'KwliOZ-iźbи]}52éKB޶Qg?FdRpirOnM]TbS1ìNi!NK”F0~ &ړu~MM7{&)v<έZOB 銠hNrBG#:^i9cڑ<`+4ג>C>bIZW- r8- %`CȀk*TP@ *TP@ *TP@ *TTP@ =vLWK\;kʉ.+eﲠi B T Au8[5ɮdYC4ZG9(ҝe}44.ys%Êa2a>aTS*J '<%=^q^̑:{"ɼQӑ4LgRX4܈meIKRO>2S=*;t~s޴/%+JHVRx# ǖ(4r^ǻc],j=ΊA^Q@zΫJRV~4u`Z2W?5KHk>G4\2ӽ@uuʤL#ISdMrRR:TxiM7\b.S,nQnRuroeodKrcms.5oʷr*Tu)1:ӈVBZH;pO%~$#RVJM\fϓZM4g7>Nja_%lKcP1TPU_r T6y[{+[^ݽWh9^Kkrim%[䜜c~MeIRͽZDa[XaЅHބROOdq[XS+m>^',0P5.ic:"8m"#M)eҴTiz]^?idJp&&u[ H[YR[o+VRR $w'ruOnE^8%'IIׄ]WQZm)<5UjB͖ЧV BP$! % ) I'8N>8zbVܞݮRmmm\@ j'dEt6ko$OAN)'/TQ8\yPGK&9L͡:YQ[⹣EZZ3o*t-'$8W送~ MGxcW'F0|;DԷȇtk甈q5ᱸAE>;2ˑvsS@V^v;HeeZ\mCT<@k[ޗ M6k =5K?t6KFW&myh.\y((W`9"^>onpP|N˜׀xb62=[`BB_:# QVw$ ~h]q9OSo mLT+t RO'$PX˯O@ {sܶ\"Nl;->Z IH (7 -wry`}![Byd&=s u^(gѤ!>xuX/Ggl=ד]\^l[-LT $KPq JN⁷s7S$@9(]:S{鎧);HG<uuG'.]֑ݴN:sIڅoаo_iZe} (n$5(KXz:C%JYbQu՞;ԓ|rv[_a חS|'"C q"\ݸ,ųv0V9G+9JH;;ݑDO? H&؆d?$"'mֹOP.|!L=:^jj{?;\y#F[rrQqnI*m,pJMj\>{Խktn}yY.l)7 [$FjJK\BQ%*IZ _>]PaqQ̞qi52ҽpY*TP@ *TP@ *TP@ *TTP@ *T(Ylrve*Er%q`!(8%ڒ6S&oM %V&*AUa׻sRsǦZmXka me+sXiRUPp*8we'nRJ.{9(G]Er͚rw9KͿ4+c]˷ fmVF2ğsGREDeIVC XWΒi;z^5kk/^\2Ơ=[E21uxw]@{wR m.HR6绶RJ @ V+yrRv\_'GKywoxv"lgCueiew!NBP\$p2qԚ. S6[2% 8tlr\^xQx=1Mޕ\{or)|R7If5ٴ1.Q(6bX؎ZA;p*@ڲ׎]./'זOUSX-X2m]F*[RkS5}U*qq&wr]S~J( #JsF87۳zIz o"KSQNT5'6\lk$@ *TP Ek{) J-59Ǝ•Sm)%ܴݶݡG9ϯ-=0OU%yW&v/rm:4:q\.v_3ڿhӕN9m$ǕKC,Ɍ+O/H^^X'Ue6Eچiwꢱ wq’"?xBֳ}=HZTV ;D\4rܖT;rq9_^/4.k$<-v⊇IX^k=R2>ڸ8qѱ3dGY;l1^Qֱe-0)%΂ 20OR섫P@ *XnIӲ,N. f5wͦ+MZ!d)su"2ӎ Jm |~*pp#8>I8^xa.HWH.'r8c%n)in+n*~kH˱Zq\@Z[,[l(iSv[lݻkmmVרCP 'PJfuیxArHw\ix)jsx.*n29硠e-i9 ۓ0:(5nrq&EҤC[S TT^6uݾ?g,wMmS' SmtPku; "[y)TWR%ǔ^ CIK&iR3)*{Ae=Qe8<rumiOLVL8c'bnVweݏ5 o6.t}|m= Dr4= k%-PQf2d9ﴣKB-5U%A|?uK4C"q2W'7[˞丹4HYkK/8r=W2N!m_1BtN^U85ςsx_Jo q>|\|=KtD-{#Wz +rV8'}5RY%-ۿ>FTq1IM|c왖Hu EN<̅6wNR{`dz7&ujtȻnj5F.q7iO 6.Hִ!=]%JZ[Hʈ)Q'kKAUKJ>kFO샕8!*&ߍ4f+^1gaLb%,iLi%JRAY[a[-ôڃJFߋR˷Ju\̏Op[pJuQSզӽ[ޕu"~T}6 Zbˬv^%AS6W"PPR;g{iM8Eꌣv>m5W{={3\>&CKm5oZHQgĩlﻒ NѾZ~ y qBR֐ !aF0{?"{D1 79IE% K^SRm^;vچY\uƴYmXcÅb,VB|+ZqKukZ芔n7J+I+mI^>ݺrQRcr&[$I"4tVK?;g;. RyII~}q$F>rOڗxHqV $:i]7ݠh.tfaf%3'ٜؔV܈eN6keLlzj5;^U*1Rruz2OM:S(Inii=Cx3PY٧U"Ǚ+vinҰ[4Y$gjᔜl%5MFPƟ1?dY!,ͫ\_;\ӦCɉ+#s"R%}!h(\GZw뎫&'vmxcybL~fٟ{,8Q$um%C!AUx$\ZN(lӴcM4W|>IFQI5%]ivԱI_}L\fVmH˶[m}+qbۤc5 BR>QPw<7;PpR:$KX.jpu,Ƌ+[Q#K.@ik]ΰje3l2%7 6Um4)IhZTzP7ϱW.ݽڦLSZkMJxM:ZzIT4RiKS1~-1n=lv;wS\0$TQb9}[JJ%VW چޢ?t8|q*y`ҷ0~dPU# 5CvU1%=Ek]˰ߏ(2Wf0`wAHNJ*{-5-RM%1.#8{%ړɅO[u'(Y5G{@=n^4+T{S {[w;.MKiZ@KI!E RUrSmzT𚓓|KwvOVw[lXt+xdKV!k!]]Zb]2;"qcɍb㉈$-ҭmejʚmҌxr嶮ݗ~brMG/SI>ړ{Ly6($LLd[denXcjQZG{uo.~ìAMF*I\U]ꭦmIX!Nj*^bdDq"C RZ TG+o{^23r&2󤓋5$MsDaz;2P9,SϠr4s__2̶7HnsrWwa:c]n©jSSY Z|AqcE6QWY;pPCL$&8H\hPKVԶkB^#bBW(MEg^gJkf)6ږt/ǖY(y#(I)JJZZN/vb^jګV\MrK,*tFa!FCl*#q%D\#.{w.J=2xHp RI&9:WIl$FY*vm}?~Zw^*gZ߳V㎦d}\o6tAp}!ؼ8=f8duu:W\w ۅ}|ۥk+%K)RA&[^ :jRO8uIFRB3O-ǒ;һ&&vLRڔ/CH r攒DJANqq[_^[掸,M{©x׵ãI|{ui(Jt½L}n;PRymqa-P)$' 81+tbḌMb:[+[mNuY& { K&OŲ{>7F GөITp͑EL  w!_sa5kw\m}涾ּ'ppR渤hFzwU"k!4EaԬ6By#u,%VP!BօJѵڀQCڒ0Nq냳26x:dcZ0. yp8dTd%{;)mD$RA#{낈F&2`"\mD" QvIv0S̈́ƕI4ӵ{>^-%|'J,BpJ>UYNmze$Ofo)1-&kK;߅8-G+$A#~Cf\l#%{閞WO/=IcJ3k~mS&.!( [ܔKX7,i7[F_^y[c)xRׇ6.wT゗.q˽[u}T9J@:LjxrM&6;OWc{oXv{{eRNpmL[* .3q{XwKv"mF3rҷ[IۮHk԰ -yGI s?f>3_-W Nwzt'gT`LKSґϢFsux+Zi뱘RյnJVo@V-H$ q-/_|=>P!@ AΈ *Zq%yuO6P۪RNqqd$'(]:n4kz? dK6bŕDޘqI;InNh뵪~\{=VmޖLfJ` PU]̓*ĵ8kJnU*:"yjēmf)|{~]kKB6QFsq:!% Z"n?4ъbM$jܛU{ӳn#'."jo6JEm$TڊzϝllXȌuRAJRC6O$Ou{~sV+Z~P}Yf3:kZטCng0.:q抃n I JH9~O;*gYqmRJXRKV7tէi?%{Lw1ʊ]q=gާoүnMuko{۾9!>R} vQMEfDH=ͱ-IJRZ/ KIQtk.uٷ.K#IiJM/ ܒRMƠ*TP@ *TP@ *TP@ *TP@ *TPTP@ *TP@ *TP@gfwŹM禮qh""(̸0j[q*!iH e7"\lX[X)8rۚrnMŤUs3Z2rrÚ.8OǏ$VAҹIsU#&:3gŸZ%\-JV '=<);%KggGJ^my=pͩ39 ~Ow:aeOF`9]~\arc+OtON2 y6zqPoz `)'۟Bz'̨-Nd:Ówfўt.J[m#(y|!de"icA'izEr:=ҷRۍ R=JyWE Wnbv>=扺wKm<[-M)6JI@8. cXj9!4j|>[_(;\lB1em%̌pᓽN)G9JҒNnOkMtR.)JQ9)IJJb*X&htp\]XJqL}MLs1NnBJsvlP%]Ezi3OjImRRPNNrˊ3;ӥ'*Vd"ھȏc'nZ_R\)Kf4t$H^2ҲBV 8m$vO{.ܹ9p0rRN>Gc9n8k-ڙʯ[]h ee6R =䘬-̨aZ;BIwZt~VD5ZT;[? nI̶{vuMߠ߭>V% PCN4V[.$/4q^8z%1գM^}Uc0I)79Iku5ak;tb,ƞ@u:>EɖYDd!R@F(w"3fU$^p$(IPBA%DsM-5Tӌ+1Gi0HqKJq-!KJNB'Džjt{v_{|դ 8Γ9upNnN1W%NQwgΞ%fBm.U2l_ L#̊ ;9{,j^emٿnl]9jڥ4RrmTm(*?d7.3tW^qͰgaۥ749PٵD>!(q=U$9 Y``GrUv){*v鐛2{1o -il;{q]k!?4@(yRǟ-[߳J^;;Y.[qkZ֝/t)]K~'wBҷLSD mJF }\.x1;+dBc;o rˉ60A Ɏm$ߴ}!gqY㔯g ƒN22[]ϋdbOLNȢp[ ]r\a/b2-ͭڈo3Ɠ=.-yNp\[4dƒoZxg'(;EP{Kv^]M@_َͺuGVw.N!!981AjW-KR2juhDw\k;֭\ se8ӫRJԐTADJ6_:\p2sRb^QRV۫}fTeP@ *TP@ *TP@ *TP@ *TP@ *TP@ ?TP@ *TP@ *TP@h} f-n- L\}jksW;L x?'nM72\%ՆC%kC{'ZeOgnѫ]WRYڌ%'<~]Jt4G7NZc)ՖMM.Ec VlgMcuH *NFG#1u--]nח3ָ}&⥧MVN;))VnI%IP8QZ[#lHn΅uK 3A"ho8.ZIv(q7;TggjvrȻY;,ɖ.B`VrVڒ|{²|;\Je{=RІI5F訶yL veT+u&HGd]L~èJ&;,~Z|!MqJsjI-R7w(8nMZuʜ>e:5%sVqRm^馚ip}N4eܳ 95Ū,S]ܗkȗm+ߓmDN#GZqL tj Ң `XJBMZc$vҏzߕ#8lB8iLZ,߂:4[3%)Z0^b4o[snߔ˱R{= |1#c{I'jN)Is{l䓦1 kJ/7<}uX{^^gy j8BO#(W"e|;9i^oN0|OݓEYM+ƊOIa6d̸>c2ꔷݶI2zWw:{{ws(OʗdB\u›Xڲhf%nR:[x&c [jwN.)."Y1qWJ+TE(xiZѾ ܚ)V*Tg^tMc%56!KͭRZRqIPQn~SYC*4W)EڤOi5&-@3eZ2i^Ii7& T;Ց^;~䈧SOO4M+LZR˺k"^Ϣo{iCkjRb([߀hI;;̓Lfy*,k$t.Ir'' ;rN' 61vsQ.U[˟-Kn-i q \=JuM _x BJJ|[YiRKGӿZ%MITx6ZokJMIRtHzT \uvꛄX̫^ƽ1%RQDIYd)hF\9Uq.-dj{–[Kö^ i(6nD}׽OiMdw J [$yI1 ^>~Жg䮯v-|CF|Mr}7WmRCq S}jBUm HqM몟 P|>O+MICQK75BMVХ`r'R^/z#\y*m7JM)x.JI$hd]>Ν`=qarBY}!R\KJKC.Ǻ'>#떙nJ/Ë擋ER(5unw]z{˓*\+SȐRqŨJQ%DI&Tݦѭ֏(ԥoy{)qXHw[#u27-Ҷ{-ҺOnV|~Q:z8{Դ K]7gJA~ԧ vF퀕($(WZ{7]/;@,jnj/5$ n=I$j1IS4.0WuhoI]y?CHhڽ~j]߲KgCõ53a>/>/%yVJ^Co5,Fh.!) Iy96o/hq)%r%[MmmrN*TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *TP@ *T endstream endobj 122 0 obj <>stream holly endstream endobj 123 0 obj <>stream holly endstream endobj 124 0 obj <>/Filter/FlateDecode/Height 1407/Intent/RelativeColorimetric/Length 21980/Metadata 123 0 R/Name/X/Subtype/Image/Type/XObject/Width 961>>stream H׋wu7P@pgP0.(H X@҉'R3$QiX$W)(DŸU@c o܃o{}>~ջNl*'вI 6WW:]&pxP^ydyh֣Phe[T}I9,^vbtn6^CBo߯-č S0!^}cWL}/ZE\xe8CշpA)kQ@W͌U_WOWݢ l68;^X |ngzRӈqUؙPm<NR Qfn8[2(uqy4<;Rd^d뼮Hߢx{ H=ENf=H5nψtk̈xQ[ܛRX"y_i $8_WX!+ +Y A\w Y/{թg/i6u)%Df^(su}߰Iפu p~FWVxݺxlϔ?5 #SҜ)GnO_̡ر^֮<``se[ϴԅ_٤_Щ%&]xc/8ié@?7k۴Ӟy7xCu֠jP:rB'N 6wԩWST\ Mpm]܀K,VwNuT\4^]P'\@N٢._QGDET QgDu.R^SgD=ekc- `!u :>.P]?k:?X[gu~܋ /r=AuZnu:AX / j] a]]a